ID: 1026433788

View in Genome Browser
Species Human (GRCh38)
Location 7:70375333-70375355
Sequence CTGGCAAAGTTGAAATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026433788_1026433791 4 Left 1026433788 7:70375333-70375355 CCAAGAAATTTCAACTTTGCCAG 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1026433791 7:70375360-70375382 CACATTAAAATGTGTGTACCTGG No data
1026433788_1026433792 10 Left 1026433788 7:70375333-70375355 CCAAGAAATTTCAACTTTGCCAG 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1026433792 7:70375366-70375388 AAAATGTGTGTACCTGGCAATGG 0: 1
1: 1
2: 4
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026433788 Original CRISPR CTGGCAAAGTTGAAATTTCT TGG (reversed) Intronic
902313285 1:15598502-15598524 CAGGCAAAATGGACATTTCTGGG - Intergenic
902742650 1:18449813-18449835 CTGGCAAGTCTGAAATTTTTAGG + Intergenic
904943386 1:34180889-34180911 CTTTCAAATTTGAAATGTCTAGG - Intronic
904961873 1:34339834-34339856 CTCCCAAAGATTAAATTTCTGGG - Intergenic
909233595 1:73122516-73122538 CTGACAAATTTGAAATCTGTAGG - Intergenic
909872179 1:80755456-80755478 CTGCCTATGTAGAAATTTCTAGG + Intergenic
910746417 1:90579840-90579862 CTCTCAAAGTTGAAACTCCTAGG + Intergenic
912434931 1:109655174-109655196 CTGGGAAAGATAAAATGTCTAGG - Intergenic
913413757 1:118581705-118581727 CTGGTAAAGTTGGAATTAGTGGG + Intergenic
913935563 1:125040193-125040215 CTCACAGAGTTGAACTTTCTTGG + Intergenic
914444905 1:147741733-147741755 CTGGAAAAATTGAACTTTCTGGG + Intergenic
915830206 1:159121685-159121707 CTGACAAAGCTGACATTTCAAGG + Intronic
916660987 1:166922000-166922022 CTGGGAAAATGGAAACTTCTAGG - Intronic
917196376 1:172470129-172470151 CTGGCAAATATGATATTTATAGG + Intergenic
917712445 1:177700119-177700141 CTGGCAAATTAGAAATCTGTGGG + Intergenic
917844682 1:179010854-179010876 CTGGTAATGTTAACATTTCTTGG + Intergenic
919435478 1:197554389-197554411 CAGGTAAAATTTAAATTTCTAGG - Intronic
920571829 1:207023339-207023361 CTGGCAATGTGGATATTCCTAGG + Exonic
920681967 1:208080115-208080137 CTGGCAAACTGGAAATTGCATGG + Intronic
923291638 1:232551793-232551815 ATGGAAAAGTTAAAATTCCTTGG - Intronic
1064043888 10:11993619-11993641 CTGGAAATTTTGAAATTCCTTGG + Intronic
1064373296 10:14772977-14772999 ATGGCCAAGTTGATATTTGTTGG - Intronic
1064974811 10:21102594-21102616 CTGGCATGCTTGACATTTCTTGG + Intronic
1067158711 10:43804168-43804190 ATGGAGAAGTTGAAATTCCTAGG - Intergenic
1074259869 10:111841018-111841040 CTTGTAAAGTTGTTATTTCTGGG - Intergenic
1074390730 10:113056036-113056058 CTGGAAAACTTGAAAGTGCTAGG + Intronic
1078634528 11:13036691-13036713 CTAGCATTGTTTAAATTTCTTGG + Intergenic
1079227889 11:18623723-18623745 CTGACAAGTCTGAAATTTCTCGG - Intronic
1079609848 11:22418590-22418612 CTGGAAAATTTGAAATTTGTAGG + Intergenic
1080328143 11:31102238-31102260 CTGGTACAGTTGAAATTAATTGG + Intronic
1081165319 11:39801629-39801651 TTGGCAAAGTGGATAATTCTAGG + Intergenic
1082762187 11:57138093-57138115 CTGGCAATCTTGACATTCCTTGG + Intergenic
1084874632 11:72121874-72121896 CTGGGAAAGATGAGAGTTCTGGG - Intronic
1086465022 11:87044195-87044217 AAGCCAGAGTTGAAATTTCTAGG + Intronic
1087499329 11:98930774-98930796 CTGGGTAAGTTGAAATTGTTAGG + Intergenic
1087802907 11:102523271-102523293 CTGGGAAAGTTTAAAATTTTGGG + Exonic
1089984012 11:122796098-122796120 ATGGCAAAGTGGACATGTCTTGG - Intronic
1090169242 11:124584261-124584283 CTGGAAAATATGAAATTTGTGGG - Intergenic
1090892268 11:130934493-130934515 CTGGCAAGTTTGAAATCTGTAGG + Intergenic
1092012109 12:5122870-5122892 CTGGCAAGTTTGAAATCTGTAGG + Intergenic
1092494779 12:8982313-8982335 TTGCCAAATTTCAAATTTCTTGG - Intronic
1092853819 12:12654466-12654488 CTGGCAAGGTTGAAATCTGTGGG - Intergenic
1093466987 12:19459531-19459553 GGGGGAAACTTGAAATTTCTAGG + Intronic
1093684492 12:22040834-22040856 ATAGAAAAGTTGAACTTTCTGGG - Intergenic
1094186637 12:27650218-27650240 AGGGCAAAGTTGAAATTCCCTGG + Intronic
1094397880 12:30027574-30027596 CTGGCAAGTTTGAAATTTTTAGG - Intergenic
1097430193 12:59496120-59496142 CTAGCAAAGTTACAATTTCATGG - Intergenic
1098249786 12:68557568-68557590 ATGGGATAGTTGAAATCTCTGGG - Intergenic
1099378358 12:81922435-81922457 CTGGCAAGTCTAAAATTTCTAGG + Intergenic
1100095044 12:91023748-91023770 CTGGCAAGTTCCAAATTTCTAGG + Intergenic
1100100612 12:91099617-91099639 CTAACAAAGTTGACATTTATAGG - Intergenic
1101610537 12:106287372-106287394 CTGCAAAAGCAGAAATTTCTGGG - Intronic
1101661801 12:106773149-106773171 ATGGAAAACTTGAAATTACTTGG + Intronic
1106672157 13:31917748-31917770 TTGGCAAAGTTGAAATAATTAGG - Intergenic
1107672347 13:42759138-42759160 CTGGCAGGTTTGAAATTTGTAGG + Intergenic
1107678672 13:42824338-42824360 CTGTAAAAGTTGAAATTTCATGG + Intergenic
1108924372 13:55721245-55721267 CTGGCAAAGTAGAGTTTTCATGG - Intergenic
1109963828 13:69666640-69666662 CTGGCAAATTTGAAATCTATAGG - Intergenic
1110035810 13:70682063-70682085 CTTGGAAAGTTAAAATTGCTTGG + Intergenic
1110208274 13:72943811-72943833 CTGCCTAACTTGAAAGTTCTTGG - Intronic
1110794139 13:79617940-79617962 ATGGCAAAGGGGAAAGTTCTGGG + Intergenic
1111479753 13:88809551-88809573 CTGGCATAGTTCAAATTTCTGGG + Intergenic
1111642780 13:90992008-90992030 GTGGCTAAGTTGAATTTTTTTGG - Intergenic
1112333546 13:98495998-98496020 CTGGCACAGCTGCAACTTCTGGG - Intronic
1115140126 14:30161081-30161103 ATGCAATAGTTGAAATTTCTAGG + Intronic
1117004619 14:51407295-51407317 CTTGCAAAGTTGGAATATCAAGG + Intergenic
1119935975 14:78592925-78592947 CTTGCAAAGTGGAAAGATCTGGG + Intronic
1120075193 14:80148380-80148402 ATGGAAAAGGTGAAATTTCCAGG - Intergenic
1125879873 15:43184970-43184992 CTGTCAAAGGTGCAATTTCAGGG + Exonic
1126161038 15:45613635-45613657 CTGGCAAGTCTGAAATTTGTAGG + Intronic
1127289691 15:57559232-57559254 CTGCCACATTTGTAATTTCTTGG - Intergenic
1130887171 15:88103372-88103394 CTGGCAAGTTTGAAATCTGTAGG - Intronic
1135484751 16:22854303-22854325 CTGGCAAAGTTCTAACTTCAAGG - Intronic
1135661419 16:24300373-24300395 CTGGCAAACTGGAAATTGCATGG + Intronic
1138789161 16:59881990-59882012 CTGGCACACTTGAAATTAATTGG + Intergenic
1141024845 16:80536833-80536855 CTGGCCAAGTAGAAGTTTCTTGG + Intergenic
1146968638 17:37054412-37054434 ATGTAAAAGTTGAAATTGCTTGG + Intronic
1149573708 17:57696259-57696281 CTGGCAAAGTGGCAATGTCACGG + Intergenic
1150886265 17:69089882-69089904 CTGGCACTGGTAAAATTTCTGGG + Intronic
1153855361 18:9139096-9139118 CTGGGAAAGTGGAAATCTCTGGG + Intronic
1157063186 18:44317607-44317629 CTGGCCAACTTTAAATTCCTAGG + Intergenic
1157585994 18:48801523-48801545 GTGGCAAAGTTCAAAGTTGTGGG + Intronic
1157667319 18:49498776-49498798 CTGTCAAATTTTAAATTTTTTGG - Intergenic
1158122153 18:54060292-54060314 CTGGCAAATCTGAAATTTATAGG + Intergenic
1158189980 18:54816176-54816198 CTGGCACAATTGATATTTTTTGG - Intronic
1158233999 18:55292297-55292319 TTAGCAAAGTTTACATTTCTTGG - Intronic
1158799613 18:60890768-60890790 CTGGCAAGTCTGAAATTTGTAGG + Intergenic
1159153993 18:64558201-64558223 CTGGCAAGTGTGAAATTTATAGG - Intergenic
1163333354 19:16655797-16655819 CTGAAAAAGTAGAAATTTCTGGG - Intronic
1164324328 19:24178778-24178800 CAGGCTGATTTGAAATTTCTGGG - Intergenic
1165199178 19:34131591-34131613 CTGGCAGAAGTAAAATTTCTGGG - Intergenic
1165227060 19:34362365-34362387 CTGGAATAGTTGAAGCTTCTGGG + Intronic
1165855812 19:38878831-38878853 CTGGAAGAGTTAAAAGTTCTGGG + Exonic
1166614115 19:44227775-44227797 CTGGCCAGGTTCAAATTTCAAGG - Intronic
1166655715 19:44610171-44610193 CTGGCAAGGTAGAGCTTTCTCGG + Intergenic
1167773009 19:51532675-51532697 CTGACAAAATTAAAATTTTTAGG + Intergenic
1168503833 19:56916247-56916269 CTGGCAAAGTGGAGAATCCTGGG + Intergenic
928516507 2:32049457-32049479 GTGTCAAAGTGAAAATTTCTGGG - Intergenic
930646898 2:53920192-53920214 ATGGAAAACTTGAAATGTCTAGG - Exonic
930881349 2:56274353-56274375 CTGACAAGTTTGAAATTTTTAGG + Intronic
931073157 2:58677824-58677846 CTGGCAATTCTGAAATTTGTAGG + Intergenic
931674321 2:64678568-64678590 CTCTGAAAGTTGAATTTTCTTGG - Intronic
932146266 2:69320485-69320507 CTGTCAAATTTGATATGTCTGGG + Exonic
933506605 2:83183634-83183656 ATGGGAAAATGGAAATTTCTGGG - Intergenic
936284674 2:111173044-111173066 CTGGCAAAGCTGAAATGCCCTGG - Intergenic
936613265 2:114022799-114022821 CTGGCAAGCCTGAAATTTGTAGG - Intergenic
936790370 2:116144227-116144249 GTAGCAAAGTTGAACTTGCTTGG + Intergenic
939133520 2:138266662-138266684 CTGGAAAAGTGGAAAATTTTAGG - Intergenic
939164299 2:138623634-138623656 CTGGGAAAGATAAAATGTCTTGG + Intergenic
940738921 2:157484923-157484945 ATGGCAAAGATGAAATTTGGTGG - Intronic
940939247 2:159538907-159538929 ATGGAAAAGTTGAATTCTCTTGG - Intronic
942169372 2:173274947-173274969 ATGGTACAGTTGAATTTTCTTGG + Intergenic
943935628 2:193911914-193911936 TTGGCTAAATTGACATTTCTGGG - Intergenic
944243325 2:197507082-197507104 CTGGTAAACTTAAAATTTCAGGG + Intronic
944998508 2:205322229-205322251 TAGGCAAAGTATAAATTTCTTGG - Intronic
945056968 2:205877844-205877866 CTGGCAAACTTGAGATTTGTAGG + Intergenic
945403513 2:209419036-209419058 CTGGAATAGTCCAAATTTCTAGG - Intergenic
945614440 2:212050248-212050270 CTGGCAAAGTTTAGATTTAGGGG + Intronic
945965578 2:216182935-216182957 CTGGCAAATTTTAAGTTTCCTGG - Intronic
946504476 2:220283999-220284021 GTTGCAATGTTGAAATTTGTAGG + Intergenic
948718295 2:239880414-239880436 CTGGCATAGGTGCAATGTCTTGG + Intergenic
948881952 2:240863371-240863393 CTAGCAAGGTTGAAATTTCAGGG - Intergenic
1168948101 20:1778166-1778188 CTGGCACAGTTGAAAGTTTCTGG - Intergenic
1169955202 20:11094781-11094803 CTGGGAGAGTTGACAGTTCTAGG - Intergenic
1170744786 20:19089873-19089895 CTGTCAACCTTGAAGTTTCTGGG - Intergenic
1172741111 20:37168215-37168237 CTTGAAAAGCTGAAATTCCTAGG - Exonic
1173657146 20:44707479-44707501 CTTACAAATTTGAAAATTCTGGG + Intergenic
1174409667 20:50326585-50326607 CTGGCAAATGTGAAATTTGTAGG + Intergenic
1177383844 21:20382497-20382519 CTGACAAAGGTGTAATATCTAGG + Intergenic
1178331526 21:31698839-31698861 CTAGCAAATTTGAAATTTGCAGG - Intronic
1178703331 21:34852605-34852627 CAGGCCAAGCTGAAAGTTCTGGG - Intronic
1179311244 21:40198065-40198087 CTGAGAAAGTGGAAATTTCAAGG - Intronic
1180735815 22:18016557-18016579 CTGGAAAAGTTGAAACTACAGGG - Intronic
1182168202 22:28198144-28198166 ATGCCAAAGTTGAAAATTCCTGG - Intronic
1182618589 22:31605227-31605249 CTTGCAAAGCTGAATTTTGTAGG - Intronic
1183550452 22:38480044-38480066 CTTACTGAGTTGAAATTTCTGGG - Intronic
1185189613 22:49426673-49426695 CTGACAAGGTTGAAATCTGTAGG + Intronic
950572008 3:13807094-13807116 CTGGCAATTGTGAGATTTCTCGG + Intergenic
950833292 3:15896173-15896195 GTGGCAAATTTGAAATATCTGGG + Intergenic
952155525 3:30639496-30639518 CTGGCAAGTCTGAAATTTATAGG - Intronic
953041588 3:39259692-39259714 ATGGCTAAATTGAAATTTATTGG + Intergenic
954544688 3:51423162-51423184 TTGTCAGAGGTGAAATTTCTAGG - Intronic
956206251 3:66758132-66758154 CTGGCAATGCTGAAATCTGTGGG - Intergenic
956556662 3:70531364-70531386 ATGGCAAAGTAGAAATTTAAAGG - Intergenic
957036352 3:75296819-75296841 CAGGAAAAGTTGACATTTCCTGG + Intergenic
957511388 3:81192172-81192194 CTGTCAAACTTGATATTTCATGG + Intergenic
957891968 3:86371002-86371024 CTGACAAAGTTTATATTTCCAGG + Intergenic
959437365 3:106333098-106333120 CTGCCTAAGTTGAAATGACTGGG + Intergenic
961080091 3:124019278-124019300 CAGGAAAAGTTGACATTTCCTGG + Intergenic
961972104 3:130979275-130979297 CTGGGACAGCTGACATTTCTTGG + Exonic
961990300 3:131182686-131182708 CTGGCAAAGTAAATATTTGTAGG + Intronic
962899222 3:139743842-139743864 CTGGGAAACCTGTAATTTCTGGG + Intergenic
963055694 3:141184763-141184785 CTAGCGACCTTGAAATTTCTAGG + Intergenic
963230329 3:142903071-142903093 CTGGGAAACTAGAAAATTCTAGG + Intergenic
963675694 3:148307838-148307860 CTAAGAAAGTTGAAGTTTCTCGG - Intergenic
965413992 3:168369306-168369328 CTTGCAAAGTTAATATTACTAGG - Intergenic
969271707 4:6107674-6107696 CTGGCAAATCTGAAATGTGTAGG - Intronic
970362642 4:15325296-15325318 CTGGCAAGTTTGAAATTTGTAGG + Intergenic
970821847 4:20225805-20225827 CTGGTAATTTTGAAATTTGTAGG + Intergenic
972758203 4:42073351-42073373 CTGGCAAATTCGAAATTTTGTGG + Intronic
973125551 4:46579706-46579728 CTGTGAAAGTTGAACCTTCTTGG - Intergenic
973723347 4:53747774-53747796 GTGGCAAACTAGACATTTCTAGG - Intronic
973818324 4:54639615-54639637 CTTGGAAAATTGAAAATTCTGGG + Intergenic
975840573 4:78469541-78469563 TTGTTAATGTTGAAATTTCTAGG - Intronic
976493917 4:85703980-85704002 CTGGCAAAGATAAAACTTCAGGG - Intronic
976992987 4:91392510-91392532 CAGCTAAAGATGAAATTTCTAGG + Intronic
977785403 4:101027730-101027752 ATGGTAAAAGTGAAATTTCTAGG + Intronic
978710377 4:111773159-111773181 CTGGAAAAATTGATATCTCTAGG - Intergenic
978737583 4:112101509-112101531 ATGGCAAAATTGAAATTCTTTGG + Intergenic
978968044 4:114767064-114767086 CTGGCAACTTTCAAATATCTGGG - Intergenic
981017040 4:139984661-139984683 CTGGCAAGTCTGAAATTTGTAGG + Intronic
982220830 4:153123860-153123882 CTGGCAAGCCTGAAATTTGTAGG - Intergenic
983014340 4:162592691-162592713 CTGGCAAATTTGAAATCCATGGG + Intergenic
983575630 4:169258293-169258315 CTGCCAGATTTGAACTTTCTTGG + Intronic
983929745 4:173440404-173440426 ATGGCAAATTTGAATTTTGTTGG + Intergenic
986521721 5:8626395-8626417 CTGGCAAGTCTGAAATTTGTAGG - Intergenic
986686698 5:10281111-10281133 CTGGCAAAGGAGAGATTTCAGGG + Intronic
987100875 5:14590256-14590278 CTGGCAATGTTGGAATTACTGGG + Intronic
988393131 5:30661513-30661535 ATGGCAAGGTTGCAATCTCTGGG + Intergenic
990122876 5:52477262-52477284 ATGGGAAAGTTGAAGTTTGTAGG - Intergenic
990671998 5:58142215-58142237 CTGGAAAAGTTGAAATCTTCAGG - Intergenic
990804484 5:59643390-59643412 CTGAGGAAGGTGAAATTTCTGGG + Intronic
991483888 5:67113737-67113759 CTAGCAAAGTTGTAAAATCTGGG - Intronic
995027690 5:107443316-107443338 CAGGCAAAAGAGAAATTTCTTGG + Intronic
995409444 5:111838641-111838663 CTGGCAAGTCTGAAATTTGTTGG - Intronic
995438351 5:112162198-112162220 CTGGATCATTTGAAATTTCTGGG + Intronic
995774051 5:115706647-115706669 CTGGCAAGTCTGAAATTTGTAGG - Intergenic
998871309 5:146555659-146555681 TTGGGGAAGATGAAATTTCTAGG + Intergenic
998964060 5:147519570-147519592 CTGGCATAGTGGGAAATTCTGGG + Intergenic
999292361 5:150434592-150434614 CTGGCAAAGTTGAGCTTGCCTGG - Intergenic
999590375 5:153138433-153138455 CTGGCAAAATGCAAATTCCTGGG + Intergenic
1000242783 5:159424040-159424062 CTTGCAGAGTTGAATTTTATTGG - Intergenic
1000754554 5:165141434-165141456 CTGGCAAACATGAAAATCCTGGG + Intergenic
1002557372 5:180053555-180053577 CTGGCAACCTTCAACTTTCTGGG - Intronic
1004649520 6:17595411-17595433 CTGACAAAGTTCGATTTTCTTGG - Intergenic
1005810569 6:29512216-29512238 CTGGCAAAGATGTCATTTTTAGG - Intergenic
1006122880 6:31817772-31817794 TTTGCAATGTTGAAATTTTTTGG + Exonic
1009384978 6:63077032-63077054 GTGGGAAAGTTGGATTTTCTTGG - Intergenic
1010844750 6:80691267-80691289 CTGGGAATGTGGAAATTTCCTGG + Intergenic
1012742569 6:103037040-103037062 CTGGCATAGTTGTAATTCCAAGG - Intergenic
1012976822 6:105788751-105788773 TTGGCAAATTTTAAATTCCTAGG - Intergenic
1013405027 6:109835599-109835621 TTAGCAATGTTGAAAATTCTTGG + Intergenic
1014475509 6:121867356-121867378 CTGTAAAATTTGCAATTTCTTGG - Intergenic
1014673894 6:124341165-124341187 TTTGCAAAATGGAAATTTCTGGG + Intronic
1016169106 6:140986982-140987004 CTTGCAAAGTTTAAATTTACTGG + Intergenic
1017363850 6:153609191-153609213 CTGACCTAGTTGATATTTCTAGG + Intergenic
1017547360 6:155467009-155467031 CTGGCAAGTTTGAAATTTGCAGG + Intergenic
1017900206 6:158713117-158713139 CTGGAGAATTTGAAATTTCCAGG - Intronic
1018101986 6:160448106-160448128 GTGGGAAAGTGGAAATTGCTGGG + Intronic
1019872227 7:3775116-3775138 CTGGCAATTTTGGAATTACTTGG + Intronic
1020877643 7:13718104-13718126 CTGGCAATTTTGGAATTCCTAGG - Intergenic
1021484794 7:21156026-21156048 CTTTCAAACTTGTAATTTCTTGG + Intergenic
1021834689 7:24658387-24658409 CTAGCACATTTGACATTTCTGGG + Intronic
1022063958 7:26831422-26831444 CTGGCTAAGATGAATTTTGTAGG - Intronic
1022140085 7:27486398-27486420 ATGGTAAAGCTGAGATTTCTGGG + Intergenic
1022424194 7:30252582-30252604 CTGGTAAAATGGCAATTTCTGGG + Intergenic
1022621234 7:31986664-31986686 CTGGCAATCTTGATATTCCTTGG - Intronic
1022861094 7:34367755-34367777 CTGGCAAGTCTGAAATTTGTAGG + Intergenic
1023424325 7:40019441-40019463 CTGGCAAGTCTGAAATTTGTAGG + Intronic
1023710767 7:42990027-42990049 CTTGGAAAGTTGAGATTTCCAGG - Intergenic
1024156963 7:46636037-46636059 CTGTCACAGTTAAAAGTTCTGGG - Intergenic
1024523858 7:50331390-50331412 CTGCCACTGTTGAAATTTCAAGG + Intronic
1026433788 7:70375333-70375355 CTGGCAAAGTTGAAATTTCTTGG - Intronic
1027847331 7:83398474-83398496 TTAGCAAACTTGAAATTACTTGG - Intronic
1027855301 7:83503472-83503494 CTATTAAAGTTTAAATTTCTAGG + Intronic
1028199258 7:87941456-87941478 CTTCCAAAGTTGTAATTCCTAGG - Intronic
1029968615 7:104766852-104766874 GTGGCAAAGTTCAAATTTGATGG + Intronic
1030195570 7:106850037-106850059 CTGGCAAGTTTGAAATCTGTGGG - Intergenic
1030989132 7:116279294-116279316 TTGGAAAAGTTGAAATTGCCTGG - Intergenic
1031005465 7:116465838-116465860 TTGGCTAATTTGAAATCTCTGGG - Intronic
1031495112 7:122437010-122437032 CTGGCAAAGATAAAAGTTGTGGG - Intronic
1031757324 7:125661426-125661448 GGGGGAAAGTTGAATTTTCTGGG + Intergenic
1031785213 7:126021798-126021820 CTGGAAAGTTTGAAATTTGTAGG + Intergenic
1031798461 7:126209795-126209817 CAGGATAAGTTGAAATTTCATGG - Intergenic
1031931290 7:127688405-127688427 CTGTCAGAAATGAAATTTCTGGG + Intronic
1032568070 7:132968941-132968963 CTGTGACAGTTGAAATTTCATGG - Intronic
1033686693 7:143646939-143646961 CTGGCAAAGTTGAGAGTTGATGG - Intronic
1033689041 7:143720368-143720390 CTGGCAAAGTTGAGAGTTGATGG + Exonic
1033697916 7:143810675-143810697 CTGGCAAAGTTGAGAGTTGATGG + Intergenic
1036416444 8:8553933-8553955 CTGGCAAAGTTAATTTTGCTTGG + Intergenic
1038294650 8:26279884-26279906 CTGGCAAAGTAAAAATTCCTTGG - Intergenic
1038739084 8:30200754-30200776 CTGGCAAAGATGTTCTTTCTGGG + Intergenic
1039227037 8:35399768-35399790 CTGGCAAAGAGGAACCTTCTTGG - Intronic
1041028890 8:53716148-53716170 TTGGAAAAGTTTAATTTTCTAGG - Intronic
1041593502 8:59619494-59619516 TTGAAGAAGTTGAAATTTCTGGG - Intergenic
1046238885 8:111464329-111464351 GTGGCACAGTTGAAAGTGCTGGG + Intergenic
1046472855 8:114701402-114701424 CTGGCAGATCTGAAATTTGTAGG - Intergenic
1047933224 8:129750847-129750869 ATGGCAAAGTGGTCATTTCTGGG + Intronic
1048731844 8:137450817-137450839 CTGGCAAAGTCGATTTCTCTAGG + Intergenic
1049370695 8:142263706-142263728 TTGGCAAAGTGGACTTTTCTAGG + Intronic
1050431207 9:5563752-5563774 CTGGCAAGTTTGAAATGTGTAGG + Intronic
1051023844 9:12581410-12581432 ATGGCAAAGTACAATTTTCTAGG + Intergenic
1051030280 9:12666590-12666612 ATGGCAAAGTCGAACTTTATTGG - Intergenic
1051174068 9:14346397-14346419 CTGGCCAAGTGGAAAAATCTAGG + Intronic
1051963320 9:22794825-22794847 CTGATAAAATTGAAAATTCTTGG - Intergenic
1052095324 9:24377063-24377085 CTGAAAAAGTTGAATTTTCCAGG - Intergenic
1055852261 9:80645695-80645717 CTGGCAAATCTGAAATCTATAGG - Intergenic
1055917282 9:81417637-81417659 CTGTCAAAATGGAAATGTCTTGG + Intergenic
1058841666 9:108915576-108915598 ATGGCAAGTTTGAAATTTGTGGG - Intronic
1059756034 9:117294183-117294205 CTGGCATAGTAGAAATTGCATGG - Intronic
1061909768 9:133716466-133716488 CTGGCAAAGGTGCACTCTCTGGG - Intronic
1187691875 X:21877001-21877023 CTGGTAAAGTATAAATTTATGGG - Intronic
1188920934 X:35976214-35976236 CTGGCAAGTTTGAAATTTGCAGG + Intronic
1189819486 X:44856700-44856722 CTGGCAAGTTTGAAATTTATAGG - Intergenic
1192159577 X:68774059-68774081 CTGGGAAAGAGGAAATTTCCTGG + Intergenic
1193542064 X:82784181-82784203 CTGGCAAGTCTGAAATTTATAGG - Intergenic
1194899237 X:99487471-99487493 CTGTCAAAATGGAAATTTCAAGG + Intergenic
1195305528 X:103579095-103579117 CTTTCATAGTTGAATTTTCTTGG + Intronic
1196947165 X:120838971-120838993 ATGGCAAATTTGAAATTACTAGG - Intergenic
1198157439 X:133975338-133975360 CTGGAATAGTTGGGATTTCTTGG - Intronic
1198606452 X:138343551-138343573 CTAGCAATGTTGAAATTTGAAGG - Intergenic
1199022925 X:142903691-142903713 CTGGCAAAATTGAAATCTATAGG + Intergenic
1199814195 X:151383180-151383202 CTGGAAAAATTAAAATTACTGGG + Intergenic
1200019906 X:153194448-153194470 ATGGCAAAGTTCAGATTTCATGG - Intergenic