ID: 1026433791

View in Genome Browser
Species Human (GRCh38)
Location 7:70375360-70375382
Sequence CACATTAAAATGTGTGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026433787_1026433791 17 Left 1026433787 7:70375320-70375342 CCTCACTCTGAAGCCAAGAAATT 0: 1
1: 0
2: 1
3: 15
4: 209
Right 1026433791 7:70375360-70375382 CACATTAAAATGTGTGTACCTGG No data
1026433788_1026433791 4 Left 1026433788 7:70375333-70375355 CCAAGAAATTTCAACTTTGCCAG 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1026433791 7:70375360-70375382 CACATTAAAATGTGTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026433791 Original CRISPR CACATTAAAATGTGTGTACC TGG Intronic
No off target data available for this crispr