ID: 1026438055

View in Genome Browser
Species Human (GRCh38)
Location 7:70417084-70417106
Sequence GTCTCCTCCAGCAGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026438055_1026438058 -9 Left 1026438055 7:70417084-70417106 CCCTCCACTCTGCTGGAGGAGAC 0: 1
1: 0
2: 2
3: 23
4: 244
Right 1026438058 7:70417098-70417120 GGAGGAGACAGACTCCGAGATGG 0: 1
1: 0
2: 3
3: 46
4: 385
1026438055_1026438059 0 Left 1026438055 7:70417084-70417106 CCCTCCACTCTGCTGGAGGAGAC 0: 1
1: 0
2: 2
3: 23
4: 244
Right 1026438059 7:70417107-70417129 AGACTCCGAGATGGCAATCAAGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026438055 Original CRISPR GTCTCCTCCAGCAGAGTGGA GGG (reversed) Intronic
902034442 1:13446693-13446715 ATCTCCTCCTGCAGGGAGGAGGG + Intergenic
902125613 1:14208177-14208199 GTCTCCTCCACCTTAGGGGATGG - Intergenic
902403677 1:16171843-16171865 GACTCCTCTAGCAGACTGGAGGG + Intergenic
902639479 1:17757520-17757542 GTCTCCTCCAGCACTGCGGAGGG - Intronic
903891577 1:26573586-26573608 GCCTCCCCCATCAGACTGGAGGG - Intronic
904889938 1:33772200-33772222 ATCTAATCCAGCAGGGTGGAAGG - Intronic
905460938 1:38122740-38122762 TTCTCCTCCTGCACACTGGAGGG + Intergenic
905516226 1:38564043-38564065 GTGTCCTCCAGGAGTGTGCAGGG + Intergenic
906040196 1:42783158-42783180 GTTTCCTTCAGGAGAGGGGAAGG - Intronic
907430657 1:54409380-54409402 GTCTCCCCCACCAGACTGGGAGG + Intronic
910240222 1:85078521-85078543 GGAGCCTCCAGCAGAGTGGGAGG - Intronic
912498573 1:110106933-110106955 GTCTCCAGCAGCATAGTGGTGGG + Intergenic
912864675 1:113246628-113246650 TTCCACTCCAGCAGAGGGGAGGG - Intergenic
915517115 1:156420106-156420128 TTTTCCCCCAGCAGAGTTGAGGG - Intronic
915640828 1:157224737-157224759 GTCTCCACCAGTAGAGAAGATGG - Intergenic
916169089 1:161987196-161987218 GCCTCCTTCACCAGAGTGCATGG + Intronic
917360886 1:174174798-174174820 TTATCCCCCAGCAGATTGGATGG + Intronic
918319555 1:183351767-183351789 GCCTCCTCCAGGATTGTGGAAGG - Intronic
919169054 1:193930836-193930858 GTGCACTCCAGCGGAGTGGATGG + Intergenic
919691163 1:200529770-200529792 GTCACCTCCAGCAGCGAGGTAGG + Intergenic
922704129 1:227780097-227780119 GTCTCACCCAGCATAGTGGCTGG + Intronic
922797392 1:228347200-228347222 GTCACCCCCAGAAGAATGGAAGG + Intronic
923471428 1:234294327-234294349 GTCTCGGCCAGCAGAGTAGGTGG + Intronic
924265822 1:242280921-242280943 GTCTCCTTCAGAAGACTTGAGGG + Intronic
924508515 1:244709329-244709351 GACTCCTCCCCCAGAGTGCAGGG + Intergenic
924531807 1:244899997-244900019 GGTACCCCCAGCAGAGTGGATGG - Intergenic
924629199 1:245721259-245721281 CTCTCCTCAAGCAGAATGGAGGG - Intergenic
1062801715 10:385904-385926 ACCTCCCCCAGCAGAGTGGCGGG - Intronic
1064209816 10:13352426-13352448 GTTTCCTCCAGCCCAGTGGAAGG - Intergenic
1065722871 10:28643265-28643287 CTCTCCTCCTGCAGAATGGCAGG + Intergenic
1067052670 10:43031590-43031612 GTTTCCTCCATCAAACTGGAGGG + Intergenic
1067944629 10:50682240-50682262 GTCACCTCCAGCTGTGGGGATGG + Intergenic
1068104077 10:52591976-52591998 CTCTCCTCAAGCAGAATGAAGGG + Intergenic
1069995344 10:72338585-72338607 GCTTCCTCCAGGAGAATGGAAGG + Intronic
1070879925 10:79847242-79847264 GTCACCTCCAGCTGTGGGGATGG + Intronic
1071371233 10:84953720-84953742 CTTTCCTCCTGCAGAGTGAAAGG - Intergenic
1071633034 10:87231332-87231354 GTCACCTCCAGCTGTGGGGATGG + Intronic
1071646483 10:87363550-87363572 GTCACCTCCAGCTGTGGGGATGG + Intronic
1072706517 10:97684994-97685016 GTCTTCTCCAGGAAATTGGAGGG - Intronic
1073149804 10:101303970-101303992 GTCTCTTCCATCAGTGGGGAGGG + Intergenic
1073905554 10:108275149-108275171 CTCTCCTCAAGCAGAAGGGAGGG + Intergenic
1074670168 10:115780915-115780937 TTCTGCTTCAGCAAAGTGGAGGG + Intronic
1075844852 10:125536912-125536934 GTCTCCTCCAGCAGCCTGGGAGG - Intergenic
1076757128 10:132578530-132578552 GTCTCATCCAGGAGAGTGTGCGG + Intronic
1077179390 11:1205459-1205481 GTCTCCAGCAGCAGGCTGGAGGG + Intergenic
1081677102 11:44976695-44976717 GTCCTCTCCTGCAGGGTGGATGG - Intergenic
1085303137 11:75470118-75470140 GACACCTGCAGCAAAGTGGAAGG + Intronic
1086594732 11:88557369-88557391 CTCTTCTCTAGCAGAGAGGAGGG + Intronic
1088368943 11:109067516-109067538 GTCCCCTCAAGCAGAGTTGTGGG - Intergenic
1089386641 11:118072726-118072748 GTCTCCTTCAGTAGACTGTAGGG + Intergenic
1089561364 11:119344918-119344940 GTCTCTGACAGCAGTGTGGAAGG - Exonic
1090096643 11:123748521-123748543 GTCTTCTGCAGCAAAATGGATGG - Intergenic
1090403551 11:126464023-126464045 GTCTCCTACAGCAGGTTGAATGG + Intronic
1090936734 11:131349558-131349580 GCCTCCTGCAGGAGAGTGGAGGG + Intergenic
1091048774 11:132349341-132349363 GACACCTGCAGAAGAGTGGAAGG + Intergenic
1092950212 12:13495854-13495876 GACTCATCCACCAGAGAGGATGG - Intergenic
1093078465 12:14781900-14781922 GTCTCTTCCAGCAGGGTACAAGG + Intergenic
1093433325 12:19107915-19107937 GTCTACTTCTGCAGCGTGGAAGG - Intergenic
1095227458 12:39694838-39694860 CTCTCCTCAAGCAGAGGGAAGGG - Intronic
1096747613 12:53738819-53738841 CTCCCCACCAGCAGAGTGGTGGG - Intergenic
1099957965 12:89369713-89369735 GTCTCCCCCAGAAGCGGGGAAGG + Intergenic
1101226611 12:102694131-102694153 CTCTCCTCAAGCAGAATGAAGGG - Intergenic
1101565777 12:105903652-105903674 GTCTCCTTATGCACAGTGGATGG - Intergenic
1102402699 12:112643984-112644006 GTCTTCTGCAGCAATGTGGATGG + Intronic
1102768179 12:115451294-115451316 GCCTCCTGCAGCCGAGAGGAAGG + Intergenic
1103981695 12:124741050-124741072 GCCTCCTCCAGGTGTGTGGAGGG - Intergenic
1104945950 12:132414966-132414988 TTCTCCTCCAGCAGAGAGAAGGG + Intergenic
1108076542 13:46686026-46686048 GTCTCCTCCAGCACAGGTGAGGG + Exonic
1109341941 13:61073677-61073699 GCCTGCACCATCAGAGTGGAAGG + Intergenic
1109527317 13:63593452-63593474 GTCTCCTTCCGCTGTGTGGAAGG + Intergenic
1111547735 13:89765226-89765248 GTCTTCTGCAGCAACGTGGATGG + Intergenic
1112675412 13:101695722-101695744 GTCTCTTGCAGCAGGGTGAAGGG - Intronic
1114324398 14:21574360-21574382 CTCTCCTCCTTCTGAGTGGATGG - Intergenic
1115435870 14:33372649-33372671 ATCTTCTCCAGGAGAGTTGAGGG + Intronic
1115789687 14:36865163-36865185 GCCTCCTCTAGCAGGGAGGAGGG - Intronic
1116056932 14:39875664-39875686 GTTTCCTCCAGCAGTATTGAGGG + Intergenic
1117264992 14:54077218-54077240 CTCTCCTCAAGCAGAAGGGAGGG + Intergenic
1118019672 14:61697085-61697107 CTCTCTGCCAGAAGAGTGGAAGG - Intronic
1120104210 14:80475951-80475973 ATCTCCTCCAGCAGTCTGCACGG + Intergenic
1122051602 14:99064732-99064754 GTCTCCTGCAGCAGAGCAGTGGG - Intergenic
1122427725 14:101621337-101621359 GGATCCTCCAGCCGAGTGGCCGG - Intergenic
1123476104 15:20593405-20593427 GTCTCCTCCAGGAGAGGTGTGGG + Intergenic
1123641908 15:22406959-22406981 GTCTCCTCCAGGAGAGGTGTGGG - Intergenic
1123880811 15:24676291-24676313 GTCTCCTCCAGGAGAGTGGCTGG - Exonic
1124139955 15:27068347-27068369 CTCTGCTCCTGCAGTGTGGATGG - Intronic
1124365501 15:29068503-29068525 GTCTACTGCAGCAGAGTGCCAGG + Intronic
1125931148 15:43600973-43600995 GTTTCCTACGGCAGAGTGGTCGG - Exonic
1125944307 15:43700791-43700813 GTTTCCTACGGCAGAGTGGTCGG - Intergenic
1127006087 15:54571699-54571721 GGCTCCTCAGGCAGAGTGGCAGG - Intronic
1127394093 15:58529710-58529732 CTGTCCTCCAGCACAGTAGAAGG + Intronic
1127532173 15:59854057-59854079 GGCTCCTGCAGCAGAGAGGGAGG + Intergenic
1128460417 15:67862715-67862737 GTCTTCTGCAGCAGCATGGATGG - Intergenic
1130093826 15:80841477-80841499 GTCTGTACCAACAGAGTGGACGG - Intronic
1130685957 15:86037850-86037872 GTCCTCTCCAGCAGTATGGATGG + Intergenic
1132496462 16:265659-265681 GTCTCCCCCAGCAGGATGGGTGG + Exonic
1133685934 16:8165601-8165623 GTCTCCTTCACCAGTGTGCATGG - Intergenic
1134810857 16:17166060-17166082 GGCTCCTCCAGCAGGCTGGTGGG + Intronic
1134816151 16:17207606-17207628 CTCTCATCCAGCAAACTGGATGG + Intronic
1135097476 16:19576664-19576686 GTCTCATCCAGCAGAGCCGTGGG - Intronic
1136384665 16:29916092-29916114 GTCTCCTGCATTAGTGTGGAGGG - Intronic
1136687145 16:32002274-32002296 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136787758 16:32945825-32945847 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136882023 16:33907964-33907986 GTTTCCTCCATCAGACTTGAGGG + Intergenic
1138356564 16:56385800-56385822 CTCTGCTCTGGCAGAGTGGAAGG - Intronic
1140070699 16:71647487-71647509 CTCTCCTCCAGCATAGGAGAAGG + Exonic
1140415110 16:74768930-74768952 GTCTTCTCAAGCAGAGGGCATGG + Intronic
1141464606 16:84197401-84197423 GTCTCCTCCAGCACACAGGCTGG - Intergenic
1141481401 16:84309102-84309124 GTCTCATCCGGCAGAGCAGACGG - Intronic
1141633003 16:85299001-85299023 CTGTCCTCCAGCAGCGAGGACGG - Intergenic
1142021995 16:87789602-87789624 GCCTTCCCCAGCTGAGTGGAAGG + Intergenic
1203089986 16_KI270728v1_random:1207482-1207504 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1147148117 17:38497943-38497965 GTTTCCTCCACCAGACTTGAGGG - Intronic
1148158678 17:45437641-45437663 GCCTCCTGCAGCAGAGGGGTGGG + Exonic
1148635593 17:49146766-49146788 CTGTCCTCCATCAGACTGGAAGG + Intronic
1148844094 17:50518578-50518600 CTCTCCTTCAGCAGAGATGAGGG - Exonic
1150390099 17:64785040-64785062 GCCTCCTGCAGCAGAGGGGTGGG + Intergenic
1150571292 17:66389332-66389354 CTCTCCTGCAGCGTAGTGGATGG + Intronic
1151671767 17:75574860-75574882 GTGTCCTTCAGCAGAGTGAGTGG + Exonic
1152363531 17:79843124-79843146 CACTCCTCCAGAAGGGTGGAGGG - Intergenic
1153920260 18:9782641-9782663 GCCTCCTCCACCAGTTTGGAGGG + Intronic
1154217789 18:12428260-12428282 CTCCCCTCCAGCAGAGTTGATGG + Intronic
1155871500 18:31034415-31034437 ATTTCCTCCAGCAAAGTGTAGGG - Intronic
1157158673 18:45292018-45292040 GTCTCCGCCAGGAAAGGGGAGGG - Intronic
1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG + Intergenic
1158649834 18:59274512-59274534 TTCACCTCCAGCAGCGCGGATGG + Intergenic
1159200534 18:65178423-65178445 TTTTCCTCCAGCAGACTGGCTGG + Intergenic
1160219164 18:76960094-76960116 GTTTGCTCCAGCAGAAGGGAAGG - Intronic
1160757211 19:764082-764104 GCCTCCTCCCTCAGACTGGATGG - Exonic
1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG + Intronic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162519961 19:11173965-11173987 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520020 19:11174188-11174210 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520036 19:11174247-11174269 GTCTCCTCTATCAAACTGGAAGG + Intronic
1163586884 19:18169073-18169095 GTCTGCCCCCACAGAGTGGACGG + Exonic
1163606048 19:18275975-18275997 GACTCCCCCATCAGACTGGAGGG + Intergenic
1163769562 19:19182633-19182655 GTCTACTTCCGCAGCGTGGAGGG - Exonic
1163812228 19:19440596-19440618 GTCACCTCCAGGAGAAGGGATGG + Intronic
1166341889 19:42142955-42142977 GTTACCTCCAGCAGAGAGGAAGG + Intronic
1166702583 19:44890924-44890946 GCCTCCTCCAGGAGAGAGGCGGG + Intronic
1167763255 19:51462440-51462462 GTATACTCGGGCAGAGTGGACGG + Intergenic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925821206 2:7801423-7801445 CTCTGCTACAGCAGTGTGGAAGG + Intergenic
926078288 2:9961075-9961097 GTTTTCTCCAGCAGAGATGAGGG - Exonic
929587483 2:43125598-43125620 GACCCCTCCAGCAGAGCTGAGGG - Intergenic
931173036 2:59824967-59824989 GTCTCCTCCAGGAGAGAGAGGGG - Intergenic
931240667 2:60449619-60449641 GTCTCCTCCATCCAAGTGGCTGG + Intergenic
931270330 2:60696214-60696236 GTCTCCTACTGAAGAGTGGAAGG - Intergenic
931441637 2:62294272-62294294 GACCCCTCCAGCTGGGTGGAAGG - Intergenic
932875001 2:75442309-75442331 GTCTTTTCCAGCAGTTTGGATGG + Intergenic
934671272 2:96214689-96214711 GCCTCATAAAGCAGAGTGGAGGG + Intergenic
936252058 2:110874601-110874623 GCCTCCTTCAGCACAGGGGAGGG + Intronic
936721287 2:115255063-115255085 CTCTCCTACGGCAGTGTGGAAGG - Intronic
938365398 2:130729467-130729489 ATCTCCTCCAGCAGCCTGGGTGG + Exonic
940596165 2:155795649-155795671 CTCTACTAGAGCAGAGTGGAAGG - Intergenic
940723376 2:157306483-157306505 CTCACCTCCAGCACTGTGGAAGG - Intronic
942419982 2:175797503-175797525 TTCTGCTCCAGCAGTGCGGAAGG + Intergenic
942715423 2:178886190-178886212 GTCTGCTCCAGCAAAGTTTAAGG - Intronic
943924295 2:193752151-193752173 GTCTCTTGCAGCAGCATGGATGG - Intergenic
944389161 2:199199526-199199548 GTCCCCACCAGCAGGGGGGAGGG + Intergenic
948655139 2:239471897-239471919 GTTTTCAGCAGCAGAGTGGAAGG + Intergenic
948686737 2:239674941-239674963 GTGTCCTCCAGGAGTGTGGTGGG + Intergenic
1171507715 20:25652567-25652589 CTCTCTGCCAGCAGAGTGGGGGG + Intergenic
1172164455 20:32890475-32890497 GTCTCCTCCTCCAGACTGGAAGG + Intronic
1172513413 20:35515898-35515920 CTCACCTCCAGCAGGGTAGAGGG - Exonic
1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG + Intergenic
1172988656 20:39014879-39014901 GCCCCCTCCAGCACAGTCGATGG + Exonic
1175299699 20:57934231-57934253 GTTTCCTCCTGCAGTGTGGAGGG - Intergenic
1175941103 20:62537873-62537895 GTTTCCTCCAGCAGAAGGCAGGG + Intergenic
1175985484 20:62762287-62762309 GTCTCATCCAGCTGAGAGGGCGG - Exonic
1176123890 20:63466530-63466552 GGCTCCTTCAGCAGAGTGGAAGG - Intronic
1179269966 21:39843330-39843352 GTGTCCTCCATCTGTGTGGAGGG + Intergenic
952243967 3:31564655-31564677 GTCTCCTCCACTGGATTGGAAGG - Intronic
952412925 3:33065481-33065503 CTCTCCTCTATCAGAATGGAGGG - Exonic
952924933 3:38313849-38313871 TTCTCCTCCAGCAGATTGGGAGG + Exonic
957494176 3:80969469-80969491 TTTGGCTCCAGCAGAGTGGAAGG - Intergenic
957663298 3:83189675-83189697 GTTTCTTCCAGCAGAGTGCTAGG - Intergenic
959741154 3:109721251-109721273 GTCTTCTGCAGCAACGTGGATGG - Intergenic
961513536 3:127419230-127419252 CTCTACTCCAGCAGAGCTGATGG + Intergenic
963434437 3:145250157-145250179 TTCTCCTCAAGCAGAATGAAGGG + Intergenic
964735204 3:159910353-159910375 GTCTTCTCCACTAGTGTGGAGGG - Intergenic
966108060 3:176361707-176361729 GTCCCCTTCCACAGAGTGGAAGG - Intergenic
967406212 3:189118864-189118886 CTCTGCTACAGCAGTGTGGAAGG + Intronic
967587756 3:191235423-191235445 GTCTCCTCCAGAACTGGGGATGG + Intronic
967737989 3:192973673-192973695 GTCTCCGCCTGCAGAGTAGCTGG - Intergenic
967777000 3:193395228-193395250 CTCTGCTACAGCAGTGTGGAAGG - Intergenic
971387431 4:26154145-26154167 GCCTCCACCCACAGAGTGGAGGG - Intergenic
973068170 4:45823097-45823119 GTCTTCTGCAGCAATGTGGATGG + Intergenic
979408305 4:120342009-120342031 GGCTCCTCCAGCAAAATGGCAGG - Intergenic
981815661 4:148828255-148828277 GTCTACACCAACAGTGTGGAGGG + Intergenic
983726481 4:170934787-170934809 ATCTCCTCCAGCAGAATGCGTGG - Intergenic
985828058 5:2207330-2207352 GTCTCCACCAGCTGAGTCGCTGG - Intergenic
992891158 5:81205694-81205716 GCTTCCTCCAGCAGAGTACATGG + Intronic
995655188 5:114418443-114418465 GTGTGCTCCAGCAGAGTAAATGG - Intronic
997726960 5:136129537-136129559 GACTCCTCCAGCAGAGTCCTTGG - Intergenic
999196237 5:149783509-149783531 GTCTCCCCCATCTGACTGGACGG - Intronic
999196490 5:149784928-149784950 GTCTCCCCCATCTGACTGGATGG + Intronic
1000290282 5:159863828-159863850 GTCTCAGCCTACAGAGTGGAGGG - Intergenic
1000305243 5:159988530-159988552 GTCTCCTCCTGGAGAGGGGAAGG - Intergenic
1000371137 5:160537863-160537885 GTCTCATCCTCCAGAGTGGCTGG + Intergenic
1000478707 5:161744576-161744598 CTCTCCTCAAGCAGAGGGAAGGG + Intergenic
1002322805 5:178385519-178385541 GTCTCCTCCAGGAGGGTGCTGGG + Intronic
1006312345 6:33269721-33269743 GTATCCTCCAGCAGAGGGAAGGG - Intronic
1006432660 6:34007496-34007518 GTCTTCAGCAGCAGTGTGGAAGG + Intergenic
1007749837 6:44065152-44065174 GTCTCTCCCATCAGATTGGAGGG - Intergenic
1008942517 6:57062327-57062349 GTATCCTCTAGCATAGTTGATGG + Intergenic
1010625272 6:78131097-78131119 CTCTCCTCAAGCAGAATGAAGGG - Intergenic
1011271025 6:85580079-85580101 CTCTCCTCAAGCAGAGGGAAAGG - Intronic
1011496546 6:87942363-87942385 GTGTGTTCCTGCAGAGTGGATGG - Intergenic
1011625575 6:89280648-89280670 CTCAGCTCCAGCAGAGTGGGCGG + Intronic
1015266094 6:131293679-131293701 GTCTCACCCAGAAGAGTGGGAGG + Intergenic
1022121703 7:27314660-27314682 GTCACCTCCAGGGCAGTGGAGGG - Intergenic
1023345846 7:39270540-39270562 CTCTTCTCCTGCAGAGTGGAAGG + Intronic
1024606673 7:51027727-51027749 CTTCCCTCCCGCAGAGTGGATGG + Exonic
1026388756 7:69878508-69878530 CTCTCCTGCAGGAGAGTGAAAGG - Intronic
1026438055 7:70417084-70417106 GTCTCCTCCAGCAGAGTGGAGGG - Intronic
1026865963 7:73824271-73824293 GACTCCTCCATCAGATTAGAGGG + Intronic
1027351461 7:77315910-77315932 GCCTCCCCCAGCAGACTGCAAGG - Intronic
1027512123 7:79096095-79096117 GGCTCCTACAGCACAGTGCAGGG - Intronic
1027765423 7:82334717-82334739 GCCACCTCTAGCAGAGAGGAAGG + Intronic
1032002451 7:128274263-128274285 TTCTCCTCCAGCACTGGGGATGG + Intergenic
1033125555 7:138704105-138704127 GACTTTTCCAGCACAGTGGAAGG - Intergenic
1034938356 7:155214139-155214161 GTCTCCTGGAGCCGAGTGGGAGG - Intergenic
1035246754 7:157567438-157567460 GCGTCCTGCAGCAGAGGGGAGGG - Intronic
1035396353 7:158537568-158537590 GTCTTCTCTGGCTGAGTGGAAGG - Intronic
1035866538 8:3089179-3089201 GGCTGCACCAGCAGAGTGGAAGG - Intronic
1038375552 8:27036728-27036750 TTCCCCTCCAGCATTGTGGAGGG + Intergenic
1038659648 8:29486198-29486220 GCCTCCTGAAGCAAAGTGGAGGG + Intergenic
1039489007 8:37933645-37933667 GTCTCCCCAACGAGAGTGGAGGG + Intergenic
1039578947 8:38648378-38648400 GACTCCTTCAGAAGAGAGGATGG - Intergenic
1044003606 8:86915359-86915381 GTGACCTCCAGCATAGTGGCTGG + Intronic
1046917248 8:119690937-119690959 GTCTCCTCTAGCTGATTGGATGG + Intergenic
1049538954 8:143197737-143197759 GTGTCCTCCAGAGGAGAGGAAGG + Intergenic
1049912566 9:283695-283717 GTCTCTTGCAGCAACGTGGATGG - Intronic
1052518171 9:29510181-29510203 CTCTCCTCAGGCAGCGTGGAAGG - Intergenic
1053008133 9:34617787-34617809 GTATCCACCAGAAGACTGGATGG + Intronic
1055664442 9:78539284-78539306 GTCTCCACCAAGAGACTGGAAGG - Intergenic
1056681264 9:88721143-88721165 CTCTCCTCCCCCAGAGTGGGTGG + Intergenic
1056855820 9:90128729-90128751 GCCTCCTCCAGGAGAGGAGAAGG - Intergenic
1057354339 9:94321894-94321916 GTCTCCTCCAGCTGTGGGGATGG - Intronic
1057653425 9:96935741-96935763 GTCTCCTCCAGCTGTGGGGATGG + Intronic
1058234197 9:102468677-102468699 GGGTCCTACAGCAGGGTGGAGGG + Intergenic
1058849644 9:108998453-108998475 GTCTCCCTCAGCAGAATGCAAGG + Intronic
1060892792 9:127199185-127199207 GGCTCCTTCAGCAGACTGGCTGG + Intronic
1061517062 9:131096310-131096332 GCGTCCTCCAGCAGAGGGGTCGG + Intergenic
1061830411 9:133289340-133289362 GTCTCCTCTATCAGAGTAAAGGG - Intergenic
1185475860 X:414953-414975 GTCTCCTCCCGCGCTGTGGAGGG - Intergenic
1186080697 X:5928468-5928490 GTCTTTTCCAGCGGAGGGGAGGG + Intronic
1186144266 X:6609496-6609518 GACTCCTCCAGCAAACTGAAAGG - Intergenic
1186774881 X:12854752-12854774 GCCCCCTCCAGGAGAGTGAAAGG + Intergenic
1186858183 X:13645929-13645951 TTCACCTCCAGCAGCCTGGATGG - Intergenic
1187118435 X:16378919-16378941 GACTTCTCCAGAAAAGTGGATGG - Intergenic
1188528396 X:31111086-31111108 GTCTCCTCTAGCAGACTGTGAGG + Intronic
1188745098 X:33831484-33831506 GTCTGCTCTGGCAGAGTGAAGGG - Intergenic
1191992543 X:67054019-67054041 GTCTCCTCATGCACAGAGGAGGG + Intergenic
1192676154 X:73199006-73199028 GTCTCCTCAAGCAGAGGGAAGGG - Intergenic
1193612146 X:83645166-83645188 CTCTCTGCCAGCAGAGAGGAGGG - Intergenic
1193903472 X:87213570-87213592 GTGTCATACTGCAGAGTGGAAGG - Intergenic
1195229552 X:102832167-102832189 GCCTGCTCCAGCTGAGAGGAGGG + Intergenic
1195736479 X:108017898-108017920 GTCAGCTCCAGCAGAGAGCAAGG + Intergenic
1196252127 X:113473479-113473501 GAATCGTCCAGCAGAGTTGAAGG - Intergenic
1196339162 X:114576676-114576698 CTCTCTTCCAGAAGAATGGAAGG - Intergenic
1196660475 X:118264035-118264057 CTCTCCTCAAGCAGAATGAAGGG - Intergenic
1197040436 X:121929993-121930015 CTCTCCTAGAGCAGTGTGGAAGG + Intergenic
1197979245 X:132198342-132198364 GCCTGCTGCAGCAGAGTGGTAGG - Intergenic
1199747096 X:150778955-150778977 GCCACCTCCAGCATAGCGGAGGG - Intronic
1199771090 X:150975854-150975876 GTCTCCTTCAGAGGAGGGGAAGG - Intergenic
1200342125 X:155408910-155408932 CTCTGCTACAGCAGTGTGGAAGG + Intergenic
1201585712 Y:15558788-15558810 GTCTACCGCACCAGAGTGGATGG - Intergenic