ID: 1026441861

View in Genome Browser
Species Human (GRCh38)
Location 7:70451936-70451958
Sequence CTGGTTCTGAGGGGCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026441852_1026441861 9 Left 1026441852 7:70451904-70451926 CCAGCAGCAGCCAGGTCGCCGCT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 214
1026441850_1026441861 13 Left 1026441850 7:70451900-70451922 CCACCCAGCAGCAGCCAGGTCGC 0: 1
1: 0
2: 1
3: 21
4: 270
Right 1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 214
1026441856_1026441861 -9 Left 1026441856 7:70451922-70451944 CCGCTCTGAGAGGTCTGGTTCTG 0: 1
1: 0
2: 1
3: 16
4: 145
Right 1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 214
1026441851_1026441861 10 Left 1026441851 7:70451903-70451925 CCCAGCAGCAGCCAGGTCGCCGC 0: 1
1: 0
2: 0
3: 19
4: 193
Right 1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 214
1026441848_1026441861 30 Left 1026441848 7:70451883-70451905 CCACAGCATGAACTGGGCCACCC 0: 1
1: 0
2: 3
3: 23
4: 158
Right 1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 214
1026441854_1026441861 -1 Left 1026441854 7:70451914-70451936 CCAGGTCGCCGCTCTGAGAGGTC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026441861 Original CRISPR CTGGTTCTGAGGGGCTCTGT GGG Intronic
900570412 1:3355488-3355510 CTAGGTCTCAGGGGCTCTGCTGG + Intronic
900713712 1:4130678-4130700 CTGGTTCTGAAGGGCCAGGTTGG + Intergenic
901162108 1:7186467-7186489 CTGGCTCTGAGTTGATCTGTTGG + Intronic
902402467 1:16165776-16165798 CCAGGTCTCAGGGGCTCTGTAGG + Intergenic
902924816 1:19689107-19689129 CAGGTCCTGTGGGTCTCTGTTGG + Intronic
904585186 1:31576237-31576259 GTGGAGCTGAGGGGCTCTGGTGG - Intergenic
905339193 1:37266653-37266675 CTGGTTCTGAGTCTCTCTGAAGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906787369 1:48627810-48627832 TGGGTTCTGAGGGACTCTGGAGG + Intronic
907241437 1:53083432-53083454 CTGGCTTTGAGGGCCCCTGTGGG + Intronic
909523284 1:76593957-76593979 CTACTTGTGATGGGCTCTGTGGG - Intronic
909922832 1:81402828-81402850 TGGCTTCTGAGGGGCTCTTTGGG - Intronic
912373800 1:109193958-109193980 CTGTTTCTCAGGTTCTCTGTAGG - Intronic
912641598 1:111351540-111351562 CTGGGTCTGTGGGTTTCTGTTGG + Exonic
914358443 1:146909134-146909156 CTGGTCCTGAGGAGCACTGGTGG - Intergenic
914494982 1:148187873-148187895 CTGGTCCTGAGGAGCACTGGTGG + Intergenic
915099829 1:153491224-153491246 CTGACTGTGAGGGGCTTTGTGGG - Intergenic
915728480 1:158035915-158035937 GTAGTTCTGTAGGGCTCTGTAGG - Intronic
920376603 1:205512132-205512154 CTGGAGCTGAGGGGCTTGGTGGG + Intronic
1064251542 10:13710097-13710119 CTGGTGCTGGCAGGCTCTGTGGG + Intronic
1064504541 10:16014522-16014544 CTAATTCTGTGGGGCTCTCTTGG + Intergenic
1064984206 10:21193532-21193554 CTGGTTGGAAGGAGCTCTGTAGG - Intergenic
1069622806 10:69848126-69848148 CTGAGACTGAGGGGCTCTGGGGG + Intronic
1069673762 10:70232960-70232982 CTGGCTCTGACAGGGTCTGTTGG - Intronic
1071433446 10:85624489-85624511 CTAGTCCTGAAGGGCTCTGTGGG - Intronic
1073422897 10:103438756-103438778 CAGCTTCTGAGGGGCTATGTAGG + Exonic
1075279011 10:121122725-121122747 CTGGGTCTTAGAGGATCTGTAGG + Intergenic
1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG + Intergenic
1076681541 10:132174363-132174385 CTTGTGCTGTGTGGCTCTGTGGG + Intronic
1079202818 11:18389950-18389972 CTGGTTATGTGGGGCTCAGGTGG + Intergenic
1080853063 11:36088144-36088166 CTGGTTTTGGGGGGCTGGGTGGG - Intronic
1084430119 11:69106384-69106406 CTGCTGCCGAGGGGCTCTGTGGG + Intergenic
1084469944 11:69353683-69353705 CTGCTTCACAGGGGCCCTGTGGG + Intronic
1084715643 11:70871706-70871728 CTGGTACTCAGGGGCCCTGCAGG + Intronic
1086044463 11:82516744-82516766 GTGGCTCTGAGGGGCTCCATGGG + Intergenic
1088853470 11:113724830-113724852 CTGGTTGTGAGGGGCCTTATGGG - Intergenic
1090963185 11:131574876-131574898 CTGGTGCTGAGGGGACCTTTGGG + Intronic
1091140296 11:133228715-133228737 CCCGTGCTGAGGGGCTCTGCAGG - Intronic
1091317683 11:134625995-134626017 CTGGTTTTCAGGAGCTCTCTGGG - Intergenic
1091849338 12:3682713-3682735 CTGGTTTTCTGTGGCTCTGTAGG - Intronic
1094207375 12:27854646-27854668 CTGGTTCTGTGGGGTTATTTTGG + Intergenic
1094847254 12:34366717-34366739 GTGGGGCTGCGGGGCTCTGTGGG + Intergenic
1094852364 12:34387994-34388016 GTGGGTCTGAGGCGCTCTGTGGG + Intergenic
1094854141 12:34395435-34395457 TTGGGTCCCAGGGGCTCTGTGGG - Intergenic
1094872774 12:34607299-34607321 CTGAGCCTGAGGTGCTCTGTGGG - Intergenic
1095944605 12:47746773-47746795 CTGACCCTGAGGGGCTCTGTGGG - Intronic
1096492345 12:52019596-52019618 CTGCTTCTGCAGGGCTCTGTGGG - Intergenic
1096561984 12:52442236-52442258 CAACTTCAGAGGGGCTCTGTGGG - Intergenic
1097685162 12:62684258-62684280 CTGGTGGTGAGGGCCTCTCTTGG + Intronic
1100357461 12:93844846-93844868 CTGCTTCTGAGGGGCTACGGTGG - Intronic
1101527014 12:105540113-105540135 CTGTTTCAAAGGGGCTCTTTGGG - Intergenic
1101728746 12:107409231-107409253 CTGGTTCTGACTGGGGCTGTTGG - Intronic
1101835348 12:108291222-108291244 CTGGTCCTGAGAGGTCCTGTGGG - Exonic
1102993442 12:117330765-117330787 CTCATTCTGAGGGGCCCTGAAGG - Exonic
1104329752 12:127833700-127833722 GTGTTTCTCAGGGGCTCTGGGGG + Intergenic
1104944718 12:132410456-132410478 CGGCTTCTGAGGGGCTGTGATGG - Intergenic
1107415531 13:40196458-40196480 CTGTCTCTCAGGTGCTCTGTGGG - Intergenic
1108372061 13:49779982-49780004 ATGGTACTGAGGGAGTCTGTAGG - Intronic
1108572161 13:51762359-51762381 CAGCCTCTGAGTGGCTCTGTGGG - Exonic
1108592765 13:51925571-51925593 CTGGAACTGAGGGGCTGTCTGGG - Intergenic
1111307853 13:86439319-86439341 CTGCTTCTGAGGGTTTCTTTTGG - Intergenic
1111341486 13:86891857-86891879 GAGGTTCTGAGGAGCTATGTTGG - Intergenic
1113850027 13:113412766-113412788 CGAGTTCTGCGGGGCGCTGTTGG - Intergenic
1119643263 14:76330157-76330179 CTGGTTCTGAGGGAGGCTCTGGG + Intronic
1119656865 14:76423529-76423551 CTGGACCCCAGGGGCTCTGTGGG + Intronic
1119667547 14:76496165-76496187 GTGTTTCTGTTGGGCTCTGTGGG + Intronic
1121408492 14:93733591-93733613 CTGGCTCTGAAAGGCTGTGTTGG + Intronic
1122239761 14:100355181-100355203 ATGGATCTGAGGTGCTCTCTGGG + Intronic
1124071080 15:26393645-26393667 CTGCTTCTTAGGGGCACTGCAGG + Intergenic
1124222745 15:27864139-27864161 CTGGTACTGATGGGCTGTGTGGG - Intronic
1124358430 15:29016430-29016452 CTGGTCCTGATGTTCTCTGTGGG + Intronic
1124482017 15:30087126-30087148 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124488475 15:30139226-30139248 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124521573 15:30410077-30410099 CAGGTTATCAGGGGCCCTGTGGG + Intronic
1124537088 15:30556142-30556164 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124543562 15:30608198-30608220 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124755054 15:32399096-32399118 CAGGTTATCAGGGGCCCTGTGGG + Intronic
1124761561 15:32451449-32451471 CAGGTTATCAGGGGCCCTGTGGG + Intronic
1124777070 15:32597619-32597641 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1128335868 15:66785487-66785509 CTGGTTGTGATGGGCTTTGCTGG + Intergenic
1129296345 15:74602329-74602351 CTGCATCTGAGGGGCTCTTTGGG - Intronic
1129798693 15:78397256-78397278 CAGCGTCTGCGGGGCTCTGTTGG + Intergenic
1130769597 15:86911233-86911255 CTGGGGCTGAGGGGCTGTGGGGG + Intronic
1130937903 15:88485593-88485615 CTGATTCTGTGGGGCCCTGGCGG + Intergenic
1132861358 16:2073304-2073326 CTGGTTCTGAGGCGCAGGGTGGG + Intronic
1133270077 16:4606899-4606921 CTGTTTCTGGGGGCCACTGTGGG - Intergenic
1134766213 16:16760461-16760483 GTGGTTCTGCTGGGCTCTGTTGG + Intergenic
1134979838 16:18598750-18598772 GTGATTCTGCTGGGCTCTGTTGG - Intergenic
1135382631 16:22007791-22007813 TTGCTTCTGAGGGGCTCAGGAGG + Intronic
1135858086 16:26030578-26030600 CTGGTTCTGATGGGCTCTACAGG - Intronic
1136541105 16:30928025-30928047 CTGGTTCTGTGGGGCTGTGTGGG + Intronic
1137765395 16:50973875-50973897 TTGGCTCTGAGGGGCTGTCTGGG + Intergenic
1138108867 16:54307435-54307457 CTGGGTAGGAGGTGCTCTGTGGG + Intergenic
1138252210 16:55509627-55509649 GTGGGTCTGAGGGGCGTTGTGGG + Intronic
1138424151 16:56919412-56919434 CTGGTGCTCAGGGGCCCTGCCGG - Intergenic
1138554432 16:57763507-57763529 CTGGCTCTGAGGGGTGCTGTGGG - Intronic
1141039050 16:80655815-80655837 CAGAGTCTGAGGGGCTCTGGAGG - Intronic
1141674513 16:85510566-85510588 CTGTTTCTGAGGCTCTCTGCTGG + Intergenic
1142376918 16:89711286-89711308 CCGGTGCGCAGGGGCTCTGTGGG + Intronic
1143095358 17:4475950-4475972 CTGGTGCTGAAGGGCCCTGGTGG + Intronic
1144176380 17:12711875-12711897 CTGATTCTGTGGGGCTGGGTTGG + Intronic
1144424008 17:15124032-15124054 CTAGTCCTCAAGGGCTCTGTGGG - Intergenic
1144950250 17:18990052-18990074 CTGTTTCTGAAGGGCTGTTTTGG + Intronic
1148684183 17:49491515-49491537 ATGGTTCTGAGGGACTCTCCAGG + Intergenic
1148972566 17:51497287-51497309 TTGGTTCTGAGGGGCATTTTGGG - Intergenic
1150267308 17:63839782-63839804 CTGGGCCTGAGGGCCTCAGTTGG + Intronic
1151313646 17:73309479-73309501 CTGGTTCTGTGAGGTGCTGTCGG + Intronic
1152031603 17:77846562-77846584 CTGGGTGCCAGGGGCTCTGTGGG - Intergenic
1152174995 17:78781845-78781867 CAGGATCTCAGGGGCTCTGAGGG - Intronic
1156854398 18:41765180-41765202 ATGGTTCTGAGTGCCTCTGATGG - Intergenic
1161060244 19:2211102-2211124 CGGGCTGTGAGGGGATCTGTAGG - Exonic
1161085189 19:2331973-2331995 GGGGTTCTGGGGGGCTGTGTTGG + Intronic
1161129165 19:2578179-2578201 CTGATTCTTAGGGGCTTTGAGGG + Intronic
1161366691 19:3883975-3883997 CTTGTTCTGAGGAGCTCACTGGG - Intronic
1162016911 19:7851075-7851097 CTGGGTCTCAGGGTGTCTGTGGG + Intronic
1163195239 19:15714782-15714804 CTGGTTCTGAGGAGCCCTCGGGG + Intergenic
1163232414 19:16013657-16013679 CTGGTTGTAAGGGGCACTGTTGG + Intergenic
1166345573 19:42163224-42163246 CCGGTTCTGGGGTGCTGTGTTGG + Intronic
925026411 2:610628-610650 CTGCCTCTGAGGGACTCTGGAGG - Intergenic
925118746 2:1401576-1401598 CTGGTCCTGAGGGGAGCTATGGG - Intronic
925911533 2:8576680-8576702 CTAGGTCTGAGGGCCTCTCTGGG - Intergenic
929586901 2:43121988-43122010 CTGGTTCAGAGAGGTGCTGTGGG - Intergenic
929765088 2:44837614-44837636 TTGGGTCTGAGGGGCTGTCTGGG + Intergenic
931321623 2:61178250-61178272 CTGGTCCGGAGGAGCTCTGAGGG + Exonic
932752371 2:74379579-74379601 CTGGTTCTGAGAGGCTTATTGGG - Intronic
933403292 2:81826222-81826244 CTGGTTCTAAGATACTCTGTTGG + Intergenic
934127907 2:88916316-88916338 CTGCCTCTGAGGGCCTCTGGTGG - Intergenic
934310758 2:91860817-91860839 CTGCCTCTGCTGGGCTCTGTAGG + Intergenic
934681530 2:96287217-96287239 CTGGGCCTGAGGGCCACTGTGGG + Intronic
934898829 2:98141027-98141049 CTGGCTCTCAGGGAATCTGTTGG + Intronic
935816299 2:106849238-106849260 CTGGCCATGAGGGGGTCTGTTGG - Intronic
935963340 2:108448805-108448827 CTGGTTCCGGGGGGCTCCTTAGG - Exonic
940048373 2:149434700-149434722 AGGGTTCTGAGAGCCTCTGTGGG - Intronic
941703546 2:168632823-168632845 CTGTTGGTGAGGGGCTTTGTTGG + Intronic
944038029 2:195320579-195320601 TTGGTTCTGATTAGCTCTGTTGG + Intergenic
946950175 2:224865632-224865654 CAGGTTGTGAGGGAGTCTGTTGG + Intronic
948681923 2:239640937-239640959 CTAGGTCCAAGGGGCTCTGTGGG - Intergenic
948884417 2:240875656-240875678 CTGGGACTGAGGGGCTCCGCAGG + Intronic
948889852 2:240902213-240902235 CAGGTCCTGAGAGGTTCTGTGGG - Intergenic
949044901 2:241867926-241867948 CTGGCTCTGGGGGGCTGTGGTGG + Intergenic
1171369394 20:24651731-24651753 CTGGTTACGAGTGGCTCAGTGGG - Intronic
1173730348 20:45324250-45324272 CTGGTTCAGAGGGGGTTTGCAGG + Intergenic
1175497660 20:59425935-59425957 CTGGTTCTGAGGGCCCCAGGTGG + Intergenic
1178186786 21:30231373-30231395 CTGGCTCTGCTGGGCTCTGCTGG - Intergenic
1179482776 21:41689086-41689108 CTGGTGATGAGGGCCTGTGTGGG - Intergenic
1179658625 21:42860857-42860879 CTGCGTCTGAGTGGTTCTGTGGG - Intronic
1179711561 21:43266468-43266490 CTGGATCTTAGGGGCTGTTTTGG - Intergenic
1179874593 21:44261641-44261663 CTGGGCCTGAGGGACACTGTAGG - Intronic
1179992634 21:44956530-44956552 CAGCATCTGAGTGGCTCTGTAGG + Intronic
1180537511 22:16406750-16406772 CTGCCTCTGCTGGGCTCTGTAGG + Intergenic
1180841461 22:18960789-18960811 CTGGTGCTGAGGGGCCTGGTGGG - Intergenic
1181760760 22:25057295-25057317 CTGGAGCTCCGGGGCTCTGTGGG + Intronic
1182416425 22:30224202-30224224 CAGGCTCTGAGGATCTCTGTGGG - Intergenic
1183234109 22:36603816-36603838 CTGGTTCTCAAGAGCTCTGATGG + Intronic
1183735552 22:39642973-39642995 CTGGCTCTGAGGGGCTCCCTAGG - Intronic
1184132929 22:42528526-42528548 CTGTGCCTGAGGGGCACTGTGGG + Intergenic
1184775475 22:46620850-46620872 CAGGTTCTGAGGGGCTTCCTGGG - Intronic
1185140914 22:49100759-49100781 CAGGTGCTGAGGGGCTCAGGAGG + Intergenic
950720784 3:14881241-14881263 CTGGTGGTGAGGGGCTCCTTTGG + Intronic
951519087 3:23594533-23594555 CTGCTTCTGAAGGCCTCTGAGGG + Intergenic
953606266 3:44415174-44415196 CTGCTGCTGAGAGTCTCTGTGGG - Intergenic
953826244 3:46253331-46253353 CTGGTTCTGGGAGGCTTTGCAGG + Intronic
955043549 3:55338845-55338867 CAGGTTCTAAAGGGCGCTGTCGG + Intergenic
955194174 3:56789611-56789633 CATGTTCTGAGGGGCTTTCTAGG - Intronic
956747831 3:72323545-72323567 CTTGTTCTGTGTTGCTCTGTAGG + Intergenic
961644290 3:128384376-128384398 CTGGTTCAGAGGTGATTTGTGGG + Intronic
963305652 3:143649734-143649756 CTATTTCAGAGGGGCTCTGGGGG + Intronic
966412499 3:179657827-179657849 CTGGTTGTCAGGGGTTGTGTAGG + Intronic
966495026 3:180570482-180570504 CTGATTATGGGGGGCTCTGGTGG + Intergenic
966681492 3:182646027-182646049 CTTGTTCTGAGAGGGTCTGCTGG + Intergenic
967093876 3:186160753-186160775 CTGGTTTTCAGGGCCTCTGCTGG - Intronic
967980277 3:195061294-195061316 CTGGCTCTGGGGCTCTCTGTGGG + Intergenic
967980442 3:195062101-195062123 CTGGCTCTGGGGCTCTCTGTGGG + Intergenic
967986298 3:195097962-195097984 CTGGGACTGTGGGACTCTGTGGG - Intronic
968312506 3:197695703-197695725 CTGTTTCTGAGGAACTCTGCAGG - Intronic
968548650 4:1211235-1211257 CTGGGTCTGTGGGACGCTGTAGG - Intergenic
968709479 4:2102470-2102492 GTGGTTGTGAGATGCTCTGTTGG - Intronic
970492603 4:16590129-16590151 CGGCTTCTCAGGGGCTCTGCTGG + Intronic
971148451 4:24005506-24005528 CTGGATCTGACAGGATCTGTAGG - Intergenic
982209606 4:153023746-153023768 ATGGCTCAGAGGTGCTCTGTGGG - Intergenic
982344263 4:154339355-154339377 CTGTTTCTGGGTGTCTCTGTGGG - Intronic
985623156 5:966580-966602 CTGGTTCTGGTGGGATCTGCTGG + Intergenic
990349294 5:54899754-54899776 CTGGTTCTGAGGGGCCCCCTGGG + Intergenic
992074980 5:73183915-73183937 CTGATTCTCTTGGGCTCTGTTGG + Intergenic
992872942 5:81024693-81024715 CTTTTTCAGAGCGGCTCTGTGGG + Intronic
995007715 5:107220738-107220760 CTGGTGTTGTGTGGCTCTGTAGG + Intergenic
995141458 5:108740090-108740112 CTGGTTGTCAGGGGTTGTGTGGG + Intergenic
998182001 5:139952460-139952482 CTGGTTTTGGGGTGCTCTGGGGG - Intronic
998263341 5:140647816-140647838 TTGATTCTGAGGTGCACTGTGGG + Exonic
1001840588 5:174873099-174873121 CAGGTTGGGAGGGGCTATGTCGG + Intergenic
1002202364 5:177537016-177537038 CTGTCTCTGAGGGTCTCTCTAGG + Intronic
1006395418 6:33783964-33783986 CTGGTTCAGAGGGTCCCTCTAGG + Intronic
1007400306 6:41599260-41599282 ATGATGCTGAGGGGCCCTGTGGG - Exonic
1007576829 6:42930426-42930448 CTGGATCTGAGGAGCCCTTTGGG + Intronic
1009960536 6:70515582-70515604 CGGGTTGTCAGGGGCTCTGGGGG + Intronic
1011482378 6:87808034-87808056 ATGGATCTGTGGGGCACTGTGGG - Intergenic
1011518164 6:88175070-88175092 CTGGTTCAGATGTGCTCTGCTGG + Intergenic
1016700876 6:147052850-147052872 CTGCTTCTAAGGGAATCTGTTGG + Intergenic
1018278539 6:162159075-162159097 CTGGTCCAGAGGGGCTCTAAGGG - Intronic
1019117455 6:169776690-169776712 CTGTTTTGGAGGGGCACTGTGGG + Intronic
1019604569 7:1901979-1902001 CTGGTACTGATGGGCTCTCAAGG + Intronic
1019610837 7:1935938-1935960 CTGGTTCTGGGGGGACCTGGGGG - Intronic
1023418354 7:39951624-39951646 CAGGCTCTGAGAGGCCCTGTGGG - Exonic
1025936064 7:66038418-66038440 CTGGTTCTGCAAGGCTCTCTGGG - Intergenic
1025948155 7:66120815-66120837 CTGGTTCTGCAAGGCTCTCTGGG + Intronic
1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG + Intronic
1033018610 7:137698645-137698667 TTGGTTCTGAGAAGCCCTGTGGG + Intronic
1033027058 7:137784812-137784834 ATGGTTTTGAGGGGTTCTTTTGG - Intronic
1034566460 7:151919638-151919660 CTGGTTCTGAGGGCCCATGTGGG - Intergenic
1035547390 8:493915-493937 AAGGTCCTGAGGGTCTCTGTTGG - Intronic
1038260417 8:25988228-25988250 CTGGCTCAGTGTGGCTCTGTGGG - Intronic
1040599973 8:48873042-48873064 CAGGTTCTGGGCAGCTCTGTGGG - Intergenic
1042179821 8:66075986-66076008 CAGTTTCTGAGGGACTCTGCTGG - Intronic
1045187618 8:99854963-99854985 CTGTTTCTCAGGGACTCAGTGGG + Intronic
1048319043 8:133384352-133384374 GTGGTTCTGAGCAGCCCTGTTGG + Intergenic
1049372531 8:142274640-142274662 CTGGTTCAGAGGAGGCCTGTGGG + Intronic
1049818742 8:144621342-144621364 CTGCGTTTGAGGGCCTCTGTTGG - Intergenic
1051091983 9:13420551-13420573 CTGCTTCTGAGGGAGTTTGTGGG - Intergenic
1056309670 9:85326862-85326884 ATGGTTTTGAGGGGCCCTTTTGG - Intergenic
1058134179 9:101288998-101289020 CAGATTGTGAAGGGCTCTGTAGG - Intronic
1058990759 9:110254136-110254158 CTGTTTCTGAGGTACTCTGTTGG - Intronic
1061420304 9:130469942-130469964 CTGGCTCTGAGGGGCTGGGTGGG + Intronic
1061606066 9:131711822-131711844 CTGGTTCTGTGGGTCTTTTTTGG - Intronic
1061994257 9:134175849-134175871 CGGGTTCTGAGGGGCTGGGGGGG + Intergenic
1062446983 9:136599248-136599270 GTGGTGCTGAGGAGCTCCGTGGG - Intergenic
1186406019 X:9303701-9303723 CTGGTTCTGAGTGTCTCAGGAGG - Intergenic
1188743334 X:33811618-33811640 TTGGGTCTCAGGGGCTGTGTGGG + Intergenic
1189293494 X:39902438-39902460 TTGGTTATGGGTGGCTCTGTAGG - Intergenic
1189802581 X:44705617-44705639 TTGAATCTGAGGGGGTCTGTGGG - Intergenic
1194726779 X:97408192-97408214 TGGGTTCTCAGGAGCTCTGTGGG + Intronic
1198547612 X:137709509-137709531 CTGAGTCAGAGGGACTCTGTGGG + Intergenic
1202182775 Y:22153665-22153687 GAGCCTCTGAGGGGCTCTGTGGG + Intergenic
1202208584 Y:22432736-22432758 GAGCCTCTGAGGGGCTCTGTGGG - Intergenic