ID: 1026442107

View in Genome Browser
Species Human (GRCh38)
Location 7:70453866-70453888
Sequence TCCTTGTAAGGTAACATTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026442105_1026442107 -2 Left 1026442105 7:70453845-70453867 CCTATCTGCAAAGATACTTTTTC 0: 1
1: 1
2: 4
3: 29
4: 337
Right 1026442107 7:70453866-70453888 TCCTTGTAAGGTAACATTTGCGG 0: 1
1: 0
2: 2
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026442107 Original CRISPR TCCTTGTAAGGTAACATTTG CGG Intronic
902205312 1:14864168-14864190 ACCTTGTAAAGAAAGATTTGAGG - Intronic
904585954 1:31580656-31580678 TCCTTAAAAGGCAACATTGGAGG + Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
906979081 1:50608708-50608730 TCATTGTAAGGTAACTTCTTTGG + Intronic
908406965 1:63824046-63824068 TTCTTAAAAGGTAAGATTTGGGG - Intronic
909291640 1:73890433-73890455 AGCTTTTAAGGGAACATTTGAGG - Intergenic
910093523 1:83493468-83493490 TCCATGTAAGATAACATTCATGG - Intergenic
910971050 1:92856347-92856369 TCTTTGGAAGGAAACATTTTTGG - Intronic
911432013 1:97801617-97801639 ACCTGAGAAGGTAACATTTGAGG + Intronic
913183173 1:116342505-116342527 TCCTTGTAAGCTATCAACTGGGG - Intergenic
915426888 1:155834729-155834751 ACCATATAAGGTAACATCTGGGG - Intronic
916429161 1:164711093-164711115 TCTGTTTATGGTAACATTTGAGG + Intronic
917135115 1:171781906-171781928 TCCCTGTGAGATACCATTTGAGG - Exonic
917542824 1:175931673-175931695 ACCTTGAAAGGGAACAGTTGAGG - Intergenic
922908818 1:229198220-229198242 AGTTTTTAAGGTAACATTTGAGG - Intergenic
923037644 1:230295801-230295823 TCCTTATAAGATAACATTTAAGG - Intergenic
1064048493 10:12040941-12040963 TCCTTGGAATGTAAAAATTGAGG - Intronic
1065630302 10:27673705-27673727 TTCATGTAACATAACATTTGGGG - Exonic
1067517219 10:46961611-46961633 TACATGTAAGGTAACACTGGAGG - Intronic
1067645029 10:48090218-48090240 TACATGTAAGGTAACACTGGAGG + Intergenic
1068407732 10:56613145-56613167 TTATTGTAAGGCAACATTTATGG + Intergenic
1069458542 10:68573108-68573130 TCCTTGAGAGGTAACTTTGGGGG - Exonic
1069463996 10:68622007-68622029 GCTATGTAAGATAACATTTGGGG - Intronic
1069676622 10:70253361-70253383 TCCTTGAAAGGCAGCATGTGGGG + Exonic
1069892925 10:71663120-71663142 TCCAAATAAGGTCACATTTGTGG + Intronic
1072753567 10:98001797-98001819 TCCCTCTAAGGAAACTTTTGAGG - Intronic
1073305346 10:102499310-102499332 TCCTTGTTGTTTAACATTTGGGG - Intronic
1074354577 10:112770704-112770726 TCTTTTTAAGAAAACATTTGGGG - Intronic
1074670474 10:115784859-115784881 TCCAAGTAAGGTCACATTTTGGG + Intronic
1078490929 11:11767788-11767810 TCCTTGTAATGTAAGAATTTAGG - Intergenic
1080329398 11:31118094-31118116 TCCTAGTAAAATAAAATTTGAGG - Intronic
1080742134 11:35076237-35076259 TCAAAGTAAGGTAGCATTTGTGG + Intergenic
1085366188 11:75947291-75947313 ACCTTGTAAAGTAACATTTCTGG + Intronic
1086098855 11:83077352-83077374 TCCTTGCAAAGAAACATTTTCGG - Intergenic
1087141519 11:94769262-94769284 TTCTTGGAATGTGACATTTGTGG + Intronic
1090156348 11:124442197-124442219 CCTTTGTAACTTAACATTTGGGG - Intergenic
1091629522 12:2149090-2149112 ACCTTGCAAGATGACATTTGGGG + Intronic
1094625968 12:32124647-32124669 TCCTGATCAGGCAACATTTGAGG + Intronic
1097370610 12:58775022-58775044 TCTTTGTATGGTGCCATTTGTGG - Intronic
1098316146 12:69195277-69195299 TCCTGGTAAGCTTACTTTTGAGG + Intergenic
1100554538 12:95680010-95680032 CCTTTGAAAGGTGACATTTGAGG - Intronic
1101854147 12:108428100-108428122 TCCAAATAAGGTAACATTTAAGG - Intergenic
1106058069 13:26257044-26257066 TCCTGGTAAAATAAAATTTGTGG + Intronic
1106838373 13:33660500-33660522 TCCTTTGATAGTAACATTTGGGG + Intergenic
1108545432 13:51488705-51488727 TCCTTGAAATGGGACATTTGAGG + Intergenic
1110837777 13:80104633-80104655 TCTTTGTATAGTAACTTTTGTGG + Intergenic
1112288567 13:98125322-98125344 AGCATGTAAGGTAACATTTTGGG - Intergenic
1113285528 13:108843622-108843644 TGCTTATAAGGTAACAATTTAGG + Intronic
1113314818 13:109167410-109167432 TCCTGCTTATGTAACATTTGGGG + Intronic
1113716379 13:112511278-112511300 TCCTGGTAAGATAAAATCTGCGG + Intronic
1117971532 14:61255463-61255485 TCCTTGTAAGGGTCCAATTGTGG + Intronic
1118236296 14:64008309-64008331 GCCTTGTGAGGTAACATGTAAGG + Intronic
1119169995 14:72527602-72527624 TCCTTGCAAGGGATGATTTGTGG - Intronic
1120154796 14:81081653-81081675 TAATTTTAAGGTAACATTTTAGG - Intronic
1124829372 15:33133132-33133154 TCCTTGTGAGTTAACTGTTGAGG - Intronic
1125056154 15:35360563-35360585 TCTTTTGAAGGTAACATATGTGG + Intronic
1125284786 15:38080744-38080766 TCCTTGAAAGCTATTATTTGGGG - Intergenic
1128248182 15:66147256-66147278 ACCATGTAAGGTGCCATTTGGGG - Intronic
1138064839 16:53929843-53929865 TGCATGTAAGGATACATTTGGGG + Intronic
1140028344 16:71312315-71312337 TCATTTTCAGGTAACATTTCAGG - Intergenic
1140586328 16:76296906-76296928 TCCATGGCAGGAAACATTTGAGG + Intronic
1141449179 16:84085864-84085886 TCCTTGTAAAGAAACATGTTTGG - Intronic
1143290639 17:5825337-5825359 TCCTTGGAAGGAAAGCTTTGGGG + Intronic
1146656846 17:34639554-34639576 TCTTTATAAGGGCACATTTGTGG - Intergenic
1147335950 17:39727086-39727108 TCCTTGAGAGGTGACAGTTGAGG - Intronic
1149972027 17:61228303-61228325 TCCTGGTAAGGCAACTTTTCTGG - Intronic
1154220792 18:12452078-12452100 TCCTTGAAAAGTTACCTTTGGGG + Intronic
1155909014 18:31487206-31487228 TACTGAGAAGGTAACATTTGAGG + Intergenic
1155929666 18:31693061-31693083 TGCTTTTAAGGAAATATTTGAGG - Intergenic
1157315271 18:46581937-46581959 TTCTTGAAAGGTAGCTTTTGTGG - Intronic
1165241829 19:34475119-34475141 TCCTGGTAAAGTAACATTTTAGG + Intergenic
1165709216 19:37997950-37997972 TCCTGGCAAGGTGCCATTTGGGG - Intronic
928194538 2:29205811-29205833 TCCTTATAAGGCAACAATTCTGG + Intronic
928926105 2:36580850-36580872 TCCTTGTAAGAGGAAATTTGGGG + Intronic
929406541 2:41649233-41649255 TCCTCTTAAGGTAACAGTTGAGG - Intergenic
933845701 2:86325432-86325454 ACCTTATAAGGTAACATTCACGG - Intronic
934103032 2:88671134-88671156 GCCATATAAGGTAACATTCGCGG - Intergenic
942768250 2:179483337-179483359 TCCTTGGAAGGAACCATTTTGGG + Exonic
943004157 2:182369200-182369222 TGCTTGTTAGGTGACTTTTGGGG - Intronic
944671947 2:202002006-202002028 TAATTGTAAGGTAATATTTCAGG - Intergenic
947459056 2:230286707-230286729 TCTTTCTAAGGTTACATATGTGG + Intronic
947985412 2:234443681-234443703 TCCATATAAGGTAACATTTATGG - Intergenic
1168881826 20:1212731-1212753 TCCATATAAGGTAACATATAAGG + Intergenic
1169188587 20:3641949-3641971 TCCTGGTAAAATAATATTTGTGG + Intronic
1169915933 20:10683372-10683394 TACTTGCAAGCTGACATTTGTGG - Intergenic
1169952573 20:11062392-11062414 TTCTTCTAAGGAAACATTTGTGG - Intergenic
1171164793 20:22960209-22960231 TCCTTGTAAGGACACATTTTGGG + Intergenic
1172231712 20:33341102-33341124 TCCTTGCCTGGTAACATCTGCGG + Intergenic
1173317300 20:41956641-41956663 TCCTTATAAGGAAAGATGTGGGG + Intergenic
1174043322 20:47715229-47715251 CCCCAGTAAGTTAACATTTGAGG - Intronic
1177345779 21:19867669-19867691 ACCTTATAAGATAACATATGTGG + Intergenic
1179530481 21:42015198-42015220 TTCATATAAGGTAACATTGGAGG + Intergenic
1182900153 22:33891169-33891191 GCCTTGAAAGATAACATTTCTGG - Intronic
1182964369 22:34507405-34507427 TACTTTAAGGGTAACATTTGAGG - Intergenic
949203793 3:1413386-1413408 GACTTGGAAGGTGACATTTGAGG + Intergenic
949436016 3:4030157-4030179 TCCTTGCAAGGAGACTTTTGGGG - Intronic
950200655 3:11040764-11040786 TTCTTCTAAGGGAACATTTCAGG - Intergenic
952584980 3:34881122-34881144 TCCTTTAAAGGTAAAATTTGAGG + Intergenic
953624293 3:44557885-44557907 TCCCTGAAAGGTGACATTTTTGG + Intronic
954017787 3:47709840-47709862 TCCTTGTAAGGCACAAGTTGTGG - Intronic
955935222 3:64096514-64096536 TCTCTGTAAGGTTGCATTTGGGG + Exonic
959411652 3:106031688-106031710 TCCTTGTATAATACCATTTGGGG + Intergenic
966559092 3:181298916-181298938 TATTTGAGAGGTAACATTTGTGG - Intergenic
970398054 4:15690916-15690938 ACCATGTAAGGTAACATTCATGG + Intronic
974866604 4:67588747-67588769 TCCTTATAGGTTACCATTTGTGG + Intronic
975428580 4:74259802-74259824 TCCTTGTAGGGCAATCTTTGAGG - Intronic
976141637 4:81999331-81999353 GTTTTGGAAGGTAACATTTGGGG - Intronic
976648831 4:87413718-87413740 TTCATGTTAGGTAACATTTATGG - Intergenic
977312163 4:95401101-95401123 TCCTTGAGATATAACATTTGAGG + Intronic
978806194 4:112803245-112803267 TCCAAGTAAGGTAACATTTAAGG - Intergenic
979415855 4:120437963-120437985 TTCTTTTAAGGGAACATTTTAGG + Intergenic
982914759 4:161193381-161193403 TCCTTGTGTGATAACATCTGCGG - Intergenic
986153930 5:5155161-5155183 TTCTTAAAAGGTAACATTTAAGG - Intronic
990113086 5:52352226-52352248 TCTTTGTAATCTAACATTGGAGG - Intergenic
991567107 5:68016759-68016781 TCCATGAAAGGTAACATTCACGG - Intergenic
992802597 5:80307353-80307375 ACCTAAAAAGGTAACATTTGTGG + Intergenic
993927126 5:93880212-93880234 TCCTTGTCAGGATACATTTTTGG + Intronic
994476468 5:100277236-100277258 TTCTGGAAAGGTAACAATTGAGG - Intergenic
995404086 5:111774370-111774392 ACCATGTAAGGTAACATATTTGG - Intronic
996090220 5:119343475-119343497 TTCTTGTAAGGTACTTTTTGGGG + Intronic
996657775 5:125961804-125961826 TTCTTGGAAGGTCACTTTTGTGG - Intergenic
996681491 5:126232226-126232248 CACTTGTAAGCTAACATGTGTGG - Intergenic
998279438 5:140791077-140791099 AACTAGTAAGGTATCATTTGAGG + Intronic
1000277258 5:159748873-159748895 TCCTTGTAGGGTAACTTTGGTGG - Intergenic
1000328749 5:160191479-160191501 CCCTAGTAAGGTAAGGTTTGGGG - Intronic
1001749459 5:174117868-174117890 ACCTTTTAAGCTACCATTTGTGG + Intronic
1002449793 5:179312155-179312177 GCCATGGAAGGTAACATTTATGG - Intronic
1005018476 6:21395632-21395654 TTCATGTCAGGTAACATTTTTGG - Intergenic
1008815931 6:55566474-55566496 TAAGTGTAAGGTGACATTTGAGG + Intronic
1009804213 6:68581295-68581317 TCCTTGTAGGGAATTATTTGTGG - Intergenic
1010309496 6:74367603-74367625 ACCCTGTAAGGTAACATCTTTGG + Intergenic
1010507699 6:76680698-76680720 TCACTGAAAGGTAACATTGGAGG + Intergenic
1011127530 6:84022994-84023016 TCTTTGTAACATAAAATTTGTGG + Intergenic
1013870557 6:114754072-114754094 TCCTTGTATTGTAAAATTTTAGG + Intergenic
1014903826 6:127002543-127002565 TCCTTCTAAGGTAACATTTCTGG + Intergenic
1015478390 6:133679114-133679136 TTCTTGTAAAGTAACAGTTTGGG - Intergenic
1016404991 6:143720410-143720432 TCCTGGGAAGGTAACATTGAAGG + Intronic
1016802416 6:148180376-148180398 TACTCTTAAGGTAACATTTTTGG - Intergenic
1018440127 6:163804722-163804744 TTCTTATAAGGTAACAGCTGTGG - Intergenic
1020360783 7:7324444-7324466 TCCTTGGAAATGAACATTTGTGG + Intergenic
1022245753 7:28557660-28557682 TCATTGGAAGGTAACATTTAAGG + Intronic
1022412215 7:30148186-30148208 TGCTGAGAAGGTAACATTTGAGG + Intronic
1022800995 7:33777242-33777264 TTTTTGTAAAGTAAGATTTGAGG - Intergenic
1026442107 7:70453866-70453888 TCCTTGTAAGGTAACATTTGCGG + Intronic
1029256890 7:99275418-99275440 TCCTTTTAAAGTAAAAGTTGTGG - Intergenic
1030301912 7:107982953-107982975 TCCCTTTAAGGTGAAATTTGTGG - Intronic
1031503018 7:122545113-122545135 AGCTTGTAAGGTAACAAATGTGG + Intronic
1032252329 7:130268892-130268914 TGCTTTTAAGGTCATATTTGTGG + Intronic
1033146779 7:138877999-138878021 TCCTTGGAAAGAAATATTTGGGG - Intronic
1033821161 7:145135537-145135559 TCTTTGTAAAGTAACATTTTTGG + Intergenic
1037866323 8:22446503-22446525 TTCTATTAAGGTAACATTTTTGG + Intronic
1037991121 8:23321880-23321902 TCCTTGCATGTTAACATCTGAGG - Intronic
1039005890 8:33036665-33036687 TGCTGGTAATGCAACATTTGTGG + Intergenic
1044052992 8:87533030-87533052 TCCTTGTAATGGAAAATTTGGGG - Intronic
1044119049 8:88371384-88371406 TCCTTGGGAGGTAACATTTGTGG + Intergenic
1044551935 8:93522087-93522109 CCCTTGGAAGGCAACATTTCTGG + Intergenic
1045265113 8:100612611-100612633 TCCTTGTTAAGGAATATTTGTGG - Intronic
1045338083 8:101226383-101226405 TCTTTGTTTGGTACCATTTGAGG + Intergenic
1046448203 8:114352774-114352796 TTCTTGAAAGATAACATTTAAGG - Intergenic
1048230312 8:132633632-132633654 GCCATGTAAGGTAACATTCATGG - Intronic
1049119809 8:140725287-140725309 ACATTTTAAAGTAACATTTGCGG - Intronic
1050172545 9:2837068-2837090 TCCTTGGCAGGTAACATTTTGGG - Intronic
1050202935 9:3167492-3167514 TCTTGGAAAGGTAACATTTGAGG - Intergenic
1052079467 9:24186340-24186362 TCCAAATAAGGTAACATTTGAGG + Intergenic
1052708394 9:32021421-32021443 TCCATGTAAGATAACATTCATGG + Intergenic
1052838761 9:33272888-33272910 TCCATGTATGCAAACATTTGTGG - Intronic
1055468199 9:76586130-76586152 TCCAAATAAGGTCACATTTGTGG + Intergenic
1058449086 9:105079535-105079557 TCCTGGGATGGGAACATTTGAGG - Intergenic
1187228549 X:17398264-17398286 TGCTTGTAACCTATCATTTGAGG + Intronic
1187830238 X:23373916-23373938 CACTTGGAAGGTAATATTTGGGG + Intronic
1188072784 X:25737391-25737413 TCATTTTCAGGTAACATTTCAGG + Intergenic
1188165514 X:26858206-26858228 TCCTTCGGTGGTAACATTTGTGG - Intergenic
1190636412 X:52438878-52438900 TCCTTTTTAGGTATCATTTAGGG + Intergenic
1192766842 X:74148445-74148467 TTCTTGTAAGGTAAGTTTGGTGG - Intergenic
1196792066 X:119472836-119472858 TCTTTGTAAGGTTAGTTTTGAGG - Intergenic
1197822669 X:130557006-130557028 TCCAAATAAGGTCACATTTGAGG - Intergenic
1201727132 Y:17166291-17166313 TCCTTATCAGGTAACATCTCAGG - Intergenic