ID: 1026442419

View in Genome Browser
Species Human (GRCh38)
Location 7:70456038-70456060
Sequence TGCCTCACAGGATTGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026442414_1026442419 27 Left 1026442414 7:70455988-70456010 CCTCTAAACTTCAGTATCCTCAG No data
Right 1026442419 7:70456038-70456060 TGCCTCACAGGATTGCTGTGAGG No data
1026442415_1026442419 10 Left 1026442415 7:70456005-70456027 CCTCAGCTTTAAAGCTAGTGTGG No data
Right 1026442419 7:70456038-70456060 TGCCTCACAGGATTGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026442419 Original CRISPR TGCCTCACAGGATTGCTGTG AGG Intronic