ID: 1026443666

View in Genome Browser
Species Human (GRCh38)
Location 7:70465375-70465397
Sequence AGGTGTACATAGTTTAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026443661_1026443666 25 Left 1026443661 7:70465327-70465349 CCTCTCAGTAGGAGAGGTTTCTC 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1026443666 7:70465375-70465397 AGGTGTACATAGTTTAGGATAGG 0: 1
1: 0
2: 0
3: 5
4: 85
1026443663_1026443666 -3 Left 1026443663 7:70465355-70465377 CCAGTGAAAAATCAGGCTTCAGG 0: 1
1: 0
2: 0
3: 28
4: 180
Right 1026443666 7:70465375-70465397 AGGTGTACATAGTTTAGGATAGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026443666 Original CRISPR AGGTGTACATAGTTTAGGAT AGG Intronic
908302406 1:62775209-62775231 CAGAGTAAATAGTTTAGGATTGG - Intergenic
909096688 1:71296585-71296607 AGGTGTTCATCGTTTGGGAAAGG + Intergenic
917377940 1:174370309-174370331 AGGTTTATAGAGTTTAGTATTGG + Intronic
919588365 1:199467880-199467902 AGGTGTACTTAGTTTACACTTGG + Intergenic
1066590639 10:36989894-36989916 ATGTGGACATAGTTTAAGATGGG + Intergenic
1069682788 10:70297171-70297193 ATCAGGACATAGTTTAGGATCGG - Intergenic
1070130224 10:73650836-73650858 AGATGTCAATAGTTTAGGAAGGG - Intronic
1079969297 11:27017090-27017112 CAGGGTATATAGTTTAGGATGGG - Intergenic
1080928149 11:36779836-36779858 AGGTATGCATAATTTGGGATGGG + Intergenic
1083297240 11:61721561-61721583 AGATGCACATGGTTGAGGATGGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1090376241 11:126291707-126291729 AGGTGGACTTAGATTAGGAAGGG - Intronic
1091504847 12:1057050-1057072 AGCTGTTCATAATTTAGCATAGG + Intronic
1091885018 12:4010657-4010679 AAGTGTATATAGTTTAGGGGTGG - Intergenic
1093050607 12:14499989-14500011 GGGTGTAGATAATTTAGGACTGG + Intronic
1095933828 12:47655533-47655555 AGGTGTTCCTACTTTAGGAGTGG + Intergenic
1106449071 13:29863564-29863586 AGGTGTACAGATTTCATGATGGG - Intergenic
1107777784 13:43864818-43864840 GTCTCTACATAGTTTAGGATGGG + Intronic
1111091439 13:83452676-83452698 TGGTGTACATAATTTCAGATGGG - Intergenic
1112790025 13:102993105-102993127 ATGTGTACAGAGTTTTGAATGGG - Intergenic
1114145327 14:19969489-19969511 AGGTGCAAAAAGATTAGGATTGG - Intergenic
1116336961 14:43668487-43668509 AGGTGCATATAGTATAAGATAGG - Intergenic
1116530492 14:45966927-45966949 AACTGTATATATTTTAGGATGGG - Intergenic
1121768743 14:96511521-96511543 AGGTGTACACAGTAAATGATCGG - Intronic
1137359746 16:47803154-47803176 AGGTGTAGATGCTTCAGGATGGG - Intergenic
1138847163 16:60580284-60580306 AGGTGGACATGGTTTATTATAGG + Intergenic
1139408705 16:66740838-66740860 AGGTGTAGGTAGTTGAGGACTGG - Intronic
1142792501 17:2278498-2278520 ATGTATATATAGTTTAGGCTGGG - Intronic
1143387490 17:6540357-6540379 AGGAGGACATAGTGTAGGAAGGG - Intronic
1143431567 17:6891541-6891563 AGAGGAACATAGTTTAGGAAAGG + Intronic
1144341190 17:14311584-14311606 TGATGTACATTGTTTAGGGTTGG + Intronic
1144693183 17:17282401-17282423 AGATGTACGTTGGTTAGGATCGG - Intergenic
1145025825 17:19467173-19467195 GCCTGTACATAGTTTAAGATGGG - Intergenic
1154462458 18:14607140-14607162 AGGTGCAAACAGATTAGGATTGG - Intergenic
1156022502 18:32616214-32616236 AGGTTTAGAAAGTTTAGGATAGG - Intergenic
926399443 2:12481600-12481622 AGGAGTTCATAGTCTAGGAGGGG + Intergenic
932080439 2:68709550-68709572 ATGTGTACAAAGCTCAGGATGGG + Intronic
932268469 2:70388296-70388318 AGGTGAGCAATGTTTAGGATGGG - Intergenic
933351294 2:81155236-81155258 ATGTCTACATAGTTTAAAATGGG - Intergenic
936039682 2:109140829-109140851 AGGTGTTGATAGTCTAAGATGGG - Intronic
936226927 2:110663348-110663370 AGGTATAGATATTTTAGAATTGG + Intronic
938977522 2:136494282-136494304 AGGTGATCTGAGTTTAGGATCGG + Intergenic
940126311 2:150329531-150329553 AGGCATACATATTTTAGGATAGG - Intergenic
940924515 2:159349175-159349197 ATCTGTACCTAGTCTAGGATCGG - Exonic
943287290 2:186018166-186018188 AGATGTACATAGTTCTGAATAGG + Intergenic
1173261510 20:41440436-41440458 AGGTATCCAGAGTTGAGGATGGG - Intronic
1176812056 21:13551241-13551263 AGGTGCAAACAGATTAGGATTGG + Intergenic
1177332261 21:19679794-19679816 ATGAGTAAATAGTTTAGCATGGG + Intergenic
1177419090 21:20832331-20832353 ATGTGTGCATAGTTTTGTATTGG + Intergenic
1182315992 22:29447737-29447759 AGGTACACATAGCTTAGGAGTGG - Intergenic
951956801 3:28265404-28265426 AGTTATACATAATTTAGAATCGG + Intronic
953361562 3:42301662-42301684 AGAAGCACATAGTTTAGGCTTGG - Intergenic
957128948 3:76198868-76198890 AGGTGTACATTGGTTTGGTTTGG - Intronic
958508299 3:95011500-95011522 AGGAATACACAGTTTAGGATTGG + Intergenic
958723885 3:97879490-97879512 AGAAGTACATAGCTTAGAATGGG - Intronic
962080401 3:132133065-132133087 AAGTGTACATTGTATGGGATGGG + Intronic
963654619 3:148030267-148030289 AGTAGTAAATAATTTAGGATAGG - Intergenic
974928806 4:68336834-68336856 AGATTTACATATTTTAGGAAAGG - Intronic
980949584 4:139360209-139360231 AGGTCTACATAATTGAGGGTAGG - Intronic
983032048 4:162814851-162814873 AGTTTTACATAGATAAGGATAGG - Intergenic
986071715 5:4291522-4291544 AGGTCTACATCTTTTAGGAACGG + Intergenic
992086705 5:73284181-73284203 AGGTTAACATACTTTAGGATGGG + Intergenic
994602650 5:101926373-101926395 AGGTGTACATAACTTATAATAGG - Intergenic
995250754 5:109990787-109990809 AGCTGGAAATATTTTAGGATGGG - Intergenic
1001075264 5:168622269-168622291 AGGTATACATAGTTCAGCTTTGG + Intergenic
1001248955 5:170131021-170131043 AGGTGAAAATAGTTTGGGAAAGG + Intergenic
1001620234 5:173077714-173077736 AAGTGTACATAGTTTCTGTTTGG - Intronic
1003259016 6:4499537-4499559 ACGTGTACAGAGTTTGGCATAGG + Intergenic
1004552956 6:16667392-16667414 ACACGTACATATTTTAGGATGGG - Intronic
1009730418 6:67596344-67596366 AGAGTTACATAGTTTAGAATGGG - Intergenic
1014139746 6:117927618-117927640 AGGTGTACATCTTTTAGGGCAGG + Intronic
1016046045 6:139481561-139481583 AGGTGTACATTGTATAGTAGAGG - Intergenic
1020646174 7:10816962-10816984 AGGTAGAGATAGTTCAGGATTGG - Intergenic
1023472836 7:40543447-40543469 GGCTCTTCATAGTTTAGGATTGG + Intronic
1026443666 7:70465375-70465397 AGGTGTACATAGTTTAGGATAGG + Intronic
1028954508 7:96673944-96673966 GGGTGTACATTTTTCAGGATGGG - Intronic
1030344991 7:108423069-108423091 AGGGGGATATAGTTGAGGATGGG + Intronic
1030811703 7:113980648-113980670 AGATTTAAATAGTTTAGCATAGG + Intronic
1036558631 8:9883248-9883270 AGGTGTAGATACTTTGGGAATGG + Intergenic
1039085690 8:33777370-33777392 ATCTGTACTTAGGTTAGGATTGG + Intergenic
1040812944 8:51476788-51476810 ATGTGAACATATTTTATGATAGG + Intronic
1043079020 8:75741275-75741297 AGCTGTACACTGCTTAGGATGGG + Intergenic
1043360136 8:79462326-79462348 AGGTGTAAATGGTTTAGAAGTGG + Intergenic
1044869282 8:96602637-96602659 TTGTGTACATAGTTCATGATGGG - Intronic
1047702472 8:127463278-127463300 GGTTGTACATATTTTAGGTTTGG - Intergenic
1051281579 9:15446726-15446748 AAGAGTAAACAGTTTAGGATTGG + Intronic
1057827401 9:98381575-98381597 AGGTGTACATGGGTTAGGGCTGG - Intronic
1058161635 9:101576370-101576392 AGGTGTTCATGGTTTAGCTTGGG - Intronic
1192522080 X:71811397-71811419 ATGGGTACATAGTTTCTGATTGG - Intergenic
1193429973 X:81390248-81390270 ATGTGTATTTAGTTGAGGATTGG + Intergenic
1194988005 X:100512134-100512156 AGGTGTATGTAGTTGAAGATGGG - Intergenic