ID: 1026445688

View in Genome Browser
Species Human (GRCh38)
Location 7:70482614-70482636
Sequence TTTGGGGGGAGGGCCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026445676_1026445688 26 Left 1026445676 7:70482565-70482587 CCTGTGCTGTTCTAGACAAAGAA 0: 1
1: 0
2: 1
3: 16
4: 171
Right 1026445688 7:70482614-70482636 TTTGGGGGGAGGGCCTCTGCAGG 0: 1
1: 0
2: 1
3: 28
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026445688 Original CRISPR TTTGGGGGGAGGGCCTCTGC AGG Intronic
900152451 1:1184568-1184590 TTTTGTGGGAGGGTCTTTGCAGG + Intronic
900393720 1:2444602-2444624 TTTAGGGAGATGGGCTCTGCTGG + Intronic
900436761 1:2634680-2634702 TCTGGGGGGACGGTCTGTGCGGG - Intergenic
900436793 1:2634780-2634802 TCTGGGGGGATGGTCTGTGCGGG - Intergenic
901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG + Exonic
902224250 1:14986747-14986769 TTGGGGTGGAGGGACTCTGTTGG + Intronic
902728143 1:18350888-18350910 GTGGGGGGTAGGGGCTCTGCAGG + Intronic
903238087 1:21963745-21963767 TTTGGGGGCAGGGGCTCAGTCGG - Intergenic
903736070 1:25530578-25530600 TGAGAGGGGAGAGCCTCTGCGGG + Intergenic
904398067 1:30236375-30236397 TTTTGGGTGAAGGCCTCTGTTGG + Intergenic
906522425 1:46475358-46475380 TGTGGGGTGAGGGCCTCGGAGGG - Intergenic
907458620 1:54592189-54592211 GTTGGTGGGTGGGCCACTGCAGG + Intronic
908804552 1:67916688-67916710 TTGGGGGAGAGGTGCTCTGCGGG + Intergenic
910200222 1:84690833-84690855 TGTGGGGGCCGGGACTCTGCAGG + Intergenic
912625324 1:111201325-111201347 TTTGAGAAGAGGGACTCTGCTGG - Exonic
914918044 1:151830332-151830354 GTTGAGGGGAGGGCCTTAGCTGG + Intronic
915520130 1:156437074-156437096 GTTGGGGGGTGGGGGTCTGCTGG - Intergenic
916052428 1:161045720-161045742 TTTGGGGGAGGGGGCTGTGCTGG - Intronic
916597156 1:166254963-166254985 TTTGGGAGGAGTGCCTATGAAGG + Intergenic
920184727 1:204152482-204152504 TGTGGGGGGGGGCTCTCTGCAGG - Intergenic
920556781 1:206909858-206909880 TTTGTGGGGAAGCCCTCTCCAGG - Exonic
920646650 1:207808562-207808584 ATTGGGGGAAGGGCATCTGTAGG + Intergenic
920883348 1:209900426-209900448 TTTGGGAGGAGGGCCTAAGTGGG - Intergenic
921160982 1:212472063-212472085 TGTGTGGGGAGGGGCTGTGCTGG - Intergenic
921680786 1:218028418-218028440 TTTGGGGGGAGGGGATGGGCAGG + Intergenic
1065467278 10:26037907-26037929 GTTGGGGGGAGGGACCCTGTGGG - Intronic
1067291892 10:44949799-44949821 TTAGGAGGTAGGGCCTTTGCAGG - Intergenic
1069943565 10:71971223-71971245 TTTGGGGAGTGGGGCACTGCTGG + Intronic
1070153477 10:73819398-73819420 TCTGGGAGCATGGCCTCTGCTGG - Intronic
1070789845 10:79182452-79182474 TTTGGGGGGAGAGTGTCAGCTGG + Intronic
1070844764 10:79513158-79513180 CTGGGGGAGGGGGCCTCTGCAGG - Exonic
1070903443 10:80050843-80050865 TTTGAGGGGAGGGCCACAGGAGG - Intergenic
1070929040 10:80247153-80247175 CTGGGGGAGGGGGCCTCTGCAGG + Intergenic
1071684977 10:87745050-87745072 ATTGTGGGGAGGGACCCTGCAGG + Exonic
1073602855 10:104863834-104863856 TTTGGAGTGAGGGCATGTGCTGG + Intronic
1075605289 10:123800990-123801012 TCTTGGGGCAGGGCCTCTGGTGG - Intronic
1075848609 10:125567761-125567783 CTTGGGGGCGGGGCCTTTGCTGG - Intergenic
1075897837 10:126013465-126013487 TTGGGTGGGAGGTCCTCTGCTGG + Exonic
1076038420 10:127221446-127221468 CTTGTGTGGAGGGCCTCTCCAGG + Intronic
1076687305 10:132203950-132203972 GTGGGGGTGAGGGGCTCTGCCGG + Intronic
1076989102 11:260275-260297 TTTGGGGGTGGGGTCTCTACAGG + Intergenic
1077168890 11:1157720-1157742 TATGTGGGGAGGACCCCTGCAGG + Intergenic
1077359086 11:2132723-2132745 TTTGGGGGGAGGGTATGTGAAGG + Exonic
1080743267 11:35084920-35084942 GTTGTGGGGAGAGGCTCTGCTGG + Intergenic
1082794945 11:57371878-57371900 TTGGGGGGGAGGGTCCCTTCAGG - Intergenic
1083682679 11:64358682-64358704 TCTGGGGAGAGGGGCCCTGCTGG + Intergenic
1084770450 11:71339690-71339712 TTTGGAGGTAGAGCCTGTGCTGG - Intergenic
1085252519 11:75152987-75153009 AGTGGGTGGAGGGGCTCTGCTGG - Intronic
1088468565 11:110168980-110169002 GTTGGGGGGAGTGCTTCTGATGG + Exonic
1089350289 11:117818192-117818214 GTTTGGGGGGTGGCCTCTGCAGG - Intronic
1089564731 11:119364492-119364514 CTTGGGGAGACGTCCTCTGCGGG - Intronic
1089685183 11:120142138-120142160 TGTGGGAGGAGGGACTCTGTGGG - Intronic
1090738567 11:129634613-129634635 CTTGTGGGGAGGGAGTCTGCAGG - Intergenic
1090828693 11:130405826-130405848 TTTGGGGGGAAGACCTCGCCAGG + Exonic
1091374755 12:18081-18103 TGTGGCGGGAGCGTCTCTGCAGG + Intergenic
1091792549 12:3280216-3280238 ACTGGGGTGGGGGCCTCTGCTGG - Intronic
1092279858 12:7090800-7090822 TGTTGGGGGAGGGCGTTTGCTGG - Intronic
1094474923 12:30833573-30833595 CTTGGGGGTGGGGCCTTTGCTGG - Intergenic
1094745659 12:33341523-33341545 TTTGAGGGTGGGGCCTTTGCTGG + Intergenic
1095556413 12:43511120-43511142 TTTGGAGGCAAGGACTCTGCAGG - Intronic
1096570664 12:52521260-52521282 TTTGGGGGTAGCTACTCTGCCGG + Intergenic
1097173724 12:57130897-57130919 TTTGGGGAGGGGTCCTCTCCTGG - Intronic
1097289978 12:57906442-57906464 TGTGGGTGGAGGGCCTTTGAAGG + Intergenic
1098048486 12:66427389-66427411 TTTGGGGGGTGGTGCTCAGCAGG - Intronic
1099668236 12:85658403-85658425 TTTTGTGGGAGGGACTCGGCAGG + Intergenic
1101020062 12:100545036-100545058 TTTGATGAGAGGGCATCTGCAGG + Intronic
1103331549 12:120157872-120157894 TGTTGGGGGAGGCCCTCAGCTGG + Exonic
1104023730 12:125011213-125011235 TATGGGGGCTGGGACTCTGCAGG - Intronic
1106287074 13:28327539-28327561 TTTGGCTGCAGGGCCTCTGATGG - Exonic
1108695515 13:52899366-52899388 TTGTGGGGGAGGGCAGCTGCTGG + Intergenic
1108695692 13:52900588-52900610 TTGTGGGGGAGGGCAGCTGCTGG + Intergenic
1109416949 13:62052346-62052368 TTTGGGTGGAGGGGGGCTGCTGG + Intergenic
1112504262 13:99966127-99966149 TGTCGGGGGAGGGGGTCTGCGGG - Intronic
1114376696 14:22154037-22154059 TTTGGGGGAAGGGGCTTTTCTGG + Intergenic
1117996514 14:61483133-61483155 TTTGGAGGGATGGCCACTGATGG - Intronic
1121329367 14:93040426-93040448 TTGGTGGTGAGGGCCTCTGCAGG - Intronic
1123019727 14:105391949-105391971 TTTGGGGGCAGGACCTCTGGGGG + Intronic
1123701730 15:22918982-22919004 TTTTGGGGCAGGGCAGCTGCAGG - Intronic
1124202137 15:27687463-27687485 TGGGAGGGGAGGGCATCTGCAGG - Intergenic
1124620784 15:31272751-31272773 TGTGGGGGCAGGGCCACGGCGGG - Intergenic
1124793012 15:32747948-32747970 TTTGGGGGATGGGCCTATACAGG + Intergenic
1125922154 15:43531348-43531370 CTTGGGGCGAGGTCCTCTCCTGG - Exonic
1128148597 15:65346999-65347021 TCTGTGGAGAGGGGCTCTGCTGG - Intronic
1132271367 15:100528946-100528968 TTTGGAGGGTGGGTCTCTGAAGG - Exonic
1132501402 16:286162-286184 GTGGGGGGGAGATCCTCTGCAGG - Intronic
1132501417 16:286196-286218 GTGGGGGGGAGGTCCTGTGCGGG - Intronic
1132501442 16:286255-286277 GTGGGGGGGAGGTCCTGTGCGGG - Intronic
1132677693 16:1127431-1127453 TGGGGGGTGAGGGCCTGTGCTGG + Intergenic
1133354714 16:5127420-5127442 TTTGAGGGGAGGAACTCTGGCGG + Intergenic
1133985987 16:10668588-10668610 TGAGGGGTGAGGGCCCCTGCTGG - Intronic
1136610851 16:31364039-31364061 TTGGGGTGGAGGGCGGCTGCAGG - Intronic
1136637864 16:31537379-31537401 TTTGGGGCGATGGGCTCTGGGGG - Intergenic
1136872920 16:33824706-33824728 TTGCGGGGCAGGGCTTCTGCCGG + Intergenic
1137273190 16:46916483-46916505 CTGGGGAGGGGGGCCTCTGCGGG + Intronic
1137555920 16:49470330-49470352 TCTGGGCGGAGGGCTTCGGCTGG + Intergenic
1138320137 16:56104708-56104730 TTTGGAGGCAGGGCCTCTTTGGG + Intergenic
1138405315 16:56788235-56788257 TGTGGTGGAAGGGCCTCTGCTGG - Intronic
1138420879 16:56898206-56898228 GTTGGGGGGAGGGCCCAGGCAGG + Intronic
1139697325 16:68684524-68684546 TTTGAGAGGAGGTCCTGTGCAGG - Intronic
1141449154 16:84085562-84085584 TTTGGGGGGGGGGCGGGTGCGGG - Intronic
1141964546 16:87432934-87432956 GTTGGCTGGGGGGCCTCTGCAGG - Intronic
1142005103 16:87685901-87685923 TTTGGGAGGAGGGTCTGTGCAGG + Intronic
1142276699 16:89122511-89122533 GTTGGGGGCAGGGGCACTGCAGG - Intronic
1203099250 16_KI270728v1_random:1291348-1291370 TTGCGGGGCAGGGCTTCTGCCGG - Intergenic
1142513259 17:410977-410999 CTTGTGAGGAGGGCCTCTGTGGG - Intronic
1142533315 17:597263-597285 GTTGGAGGGAAGGTCTCTGCCGG - Intronic
1143252041 17:5530544-5530566 GATGGTGGCAGGGCCTCTGCTGG - Exonic
1143495753 17:7311854-7311876 CTCGGGGAGGGGGCCTCTGCAGG - Exonic
1143884768 17:10057417-10057439 AATGTGGGGAGCGCCTCTGCCGG + Intronic
1144673823 17:17148186-17148208 TGTGGGCGGTGGGCCTCTGGTGG + Intronic
1145003204 17:19320056-19320078 TCTCTGGTGAGGGCCTCTGCAGG + Intronic
1147133790 17:38423857-38423879 TTTGGTGGAAGGGCCTGAGCTGG + Intergenic
1147212556 17:38880368-38880390 GTTGGGTGGAGGGCTCCTGCAGG + Intronic
1147482728 17:40782327-40782349 TTTGGGGGCAGCTCATCTGCAGG - Exonic
1147890202 17:43711603-43711625 CTTGGTGGGAGGGACTCTGAGGG - Intergenic
1148190696 17:45676771-45676793 GTTGGGGGGATGACCTGTGCGGG + Intergenic
1148805991 17:50264308-50264330 AGTGGGGGCAGGGCCTCTGCTGG + Intergenic
1148868573 17:50642296-50642318 TTAGGGGTGAGGGCCTGTGTGGG + Intronic
1150931577 17:69590528-69590550 CTTGAGGGTAGGGCCTTTGCTGG + Intergenic
1152636101 17:81431092-81431114 TGGGGGTGGAGGGGCTCTGCTGG + Intronic
1154503065 18:15005961-15005983 GGTGGGGGCAGGGCCTCTGAGGG + Intergenic
1155245461 18:23904486-23904508 TTTGGGGGGATGTCAGCTGCTGG + Intronic
1160686529 19:439302-439324 GCTGGGGGCCGGGCCTCTGCCGG - Intronic
1161778113 19:6274851-6274873 CTTGGGCAGAGGGCCTCAGCTGG + Intronic
1161993487 19:7698551-7698573 TGTGGGGTGAGGGGCTCTGGAGG + Intronic
1162471182 19:10872494-10872516 TCTGGGGAGAGGGCCCATGCGGG + Intronic
1162817792 19:13207127-13207149 TTTTGGCCGAGGGTCTCTGCGGG + Exonic
1164051446 19:21587868-21587890 TTTGGGGGGAGGGCATTTGAGGG + Intergenic
1164259909 19:23560469-23560491 CTTGAGGGGAGGGCCTAGGCAGG + Intronic
1164769357 19:30796121-30796143 TGAGGGGGGAGGGTCTCTGGAGG + Intergenic
1165263001 19:34636841-34636863 TATGGGAGGAGGGACTCTGGCGG - Intronic
1167214327 19:48154376-48154398 CGTGGGGTGAGGGCCTCTCCTGG - Intronic
1167469391 19:49666919-49666941 TTTGGAGAGAGGTCCTCAGCGGG + Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
925117609 2:1393477-1393499 TGTTGGGGGAGGGCCTGGGCTGG + Intronic
927606216 2:24489806-24489828 ATTGGGGATAGGGACTCTGCGGG + Intergenic
927814987 2:26207334-26207356 TTTGGTGGGAGGGCATTTGCTGG + Intronic
927981618 2:27378268-27378290 GTGAAGGGGAGGGCCTCTGCGGG - Exonic
929487756 2:42370084-42370106 TTATGGGGCTGGGCCTCTGCAGG + Intronic
929845379 2:45520490-45520512 TTTGAGGGTGGGGCCTTTGCCGG - Intronic
934851863 2:97706919-97706941 GCTGGGGGGAGGGCAGCTGCGGG + Intergenic
935347386 2:102121232-102121254 GTTGGGGGGCGGACATCTGCAGG - Intronic
936158239 2:110064052-110064074 GATGTGGGGAGCGCCTCTGCCGG - Intergenic
936186452 2:110307390-110307412 GATGTGGGGAGCGCCTCTGCCGG + Intergenic
936343162 2:111655379-111655401 TGTGGGAGGAAGGCCTCTGCTGG + Intergenic
936574376 2:113641282-113641304 TTTGGAGGGGGGGCCACTGGAGG - Intronic
938502230 2:131836131-131836153 GGTGGGGGCAGGGCCTCTGAGGG + Intergenic
942525549 2:176849158-176849180 GGTGGGGGGAGTGCCTGTGCAGG - Intergenic
942715511 2:178887292-178887314 TTTGGGAAGAGGGACTCTGGGGG + Intronic
947751609 2:232535541-232535563 TTTGGGGGGAGGCCCGAGGCTGG + Exonic
948282027 2:236754192-236754214 TTTGGGGAGAGAGTCTCTGGGGG + Intergenic
949044905 2:241867944-241867966 GGTGGGAGGAGGTCCTCTGCAGG + Intergenic
1169761105 20:9095263-9095285 TTTGGGGAGAGGGACTCCTCTGG + Intronic
1170557064 20:17523362-17523384 GTTGGGGAGAGGGCCTCGGAGGG + Intronic
1171044507 20:21797640-21797662 TTAGGGGGTAGGGCCTTTGCGGG + Intergenic
1173495563 20:43515002-43515024 TTCTGGGGGTGGTCCTCTGCGGG - Exonic
1174837331 20:53869844-53869866 TTTCAGGTGAGGGCCTCTGTGGG + Intergenic
1175393736 20:58644255-58644277 TTTGGGGGCTGGGCCTCAGAGGG + Intergenic
1175497336 20:59423904-59423926 TTTGGGGGGAGGACCACAGAAGG + Intergenic
1176428976 21:6564674-6564696 TTTGGGGGCAGAGCCTCTGATGG + Intergenic
1176511283 21:7750496-7750518 TGTGGGGTGAGGGGCTCGGCAGG + Intronic
1178292524 21:31381241-31381263 TTTGGAGGTGGGGCCTTTGCGGG + Intronic
1178507167 21:33171533-33171555 GTTGGGGGGAGCGCATCTCCAGG + Intergenic
1178645397 21:34381025-34381047 TGTGGGGTGAGGGGCTCGGCAGG + Intronic
1179704466 21:43172990-43173012 TTTGGGGGCAGAGCCTCTGATGG + Intergenic
1179945260 21:44669786-44669808 TCTGGGGGTAGGACCTCTGGGGG - Intronic
1180182265 21:46123292-46123314 TTTGGGGGAGGGGACTCTGGAGG - Intronic
1181144512 22:20834937-20834959 TCTGGGGGCTGGGCCTCTCCAGG + Intronic
1181977388 22:26740549-26740571 TTTGCGGGGACAGCTTCTGCTGG + Intergenic
1182639223 22:31753529-31753551 GTTAGGGTGATGGCCTCTGCTGG - Intergenic
1182671376 22:31998781-31998803 TTTCTGGAGAGGGTCTCTGCGGG - Intergenic
1182734064 22:32518260-32518282 CTTGTGGGGAGAGCCTCTGTTGG + Exonic
1183627688 22:39014606-39014628 TTTCGGGGGAGAGTCTCAGCAGG - Intronic
1183633625 22:39047736-39047758 TTTCGGGGGAGAGTCTCAGCAGG - Intronic
1183667597 22:39254467-39254489 TGTGGGGGCAGGGCCTGTCCTGG + Intergenic
1183779537 22:39989900-39989922 TTTTGGGGGAGGGTGTCTGCCGG + Intergenic
1184256174 22:43288409-43288431 TTTGGGTGGAGGGCAGCTGTGGG - Intronic
1184473944 22:44710711-44710733 TGTGGGGGAGGGGCCTCTGCGGG + Intronic
1184613520 22:45622117-45622139 GATGGGGTGAGGGCCTCTCCTGG - Intergenic
1185147802 22:49148769-49148791 GTTGTGGGGAAGGTCTCTGCTGG - Intergenic
1185147826 22:49148903-49148925 TCTGTGGGGAAGGTCTCTGCTGG - Intergenic
950119061 3:10469844-10469866 TTTGGGGAGAGGGCTGCTGATGG + Intronic
950407983 3:12816463-12816485 TGTGGGTGGAAGGCCTCAGCTGG - Exonic
952337147 3:32413886-32413908 TTTGTGGGGAGGGACTCAGCAGG - Intronic
953474372 3:43193506-43193528 TTGGGGCTGATGGCCTCTGCAGG + Intergenic
954583923 3:51718449-51718471 GTTGGGGGGAGGGGCTGGGCTGG - Intronic
954614673 3:51963658-51963680 TTGGGGCGGTGGGTCTCTGCTGG - Intronic
955228629 3:57080156-57080178 TTAAGGTGGAGGGCCTGTGCGGG + Intergenic
957760567 3:84549784-84549806 TGTGGTGGGAGGGACTCTGTGGG + Intergenic
961343174 3:126243957-126243979 CTTGAGGGTAGGGCCTTTGCTGG + Intergenic
961602452 3:128072249-128072271 TTTGGGGTGAGGCCCTGTCCAGG - Intronic
962252383 3:133843760-133843782 TTTGGGGTCAGGTCCTCTGTGGG + Intronic
962717154 3:138136531-138136553 TTTGGAGGCAGGGCCTTTGGAGG + Intergenic
963023674 3:140897687-140897709 TATGGGGTGAGGGCCTCTCCTGG + Intergenic
966915881 3:184583843-184583865 GTGGGGGGGAGGGGCTGTGCGGG + Intronic
967870726 3:194226790-194226812 TTAGGAGGTGGGGCCTCTGCTGG + Intergenic
967892804 3:194375078-194375100 GTTGCGGGGAGGGCCTGTGTGGG - Intergenic
968585673 4:1414897-1414919 TCTGGGGGGAGGGCAGCTGCGGG - Intergenic
968616670 4:1580618-1580640 GTTGGGGGCAGGGCCTGGGCAGG - Intergenic
968646903 4:1745752-1745774 TGTGGAGGGAGGCCCCCTGCAGG + Intergenic
968730069 4:2265301-2265323 TTTGGGTGGAAGGCCACGGCAGG + Intergenic
969305637 4:6324839-6324861 TTTTGGGGTTTGGCCTCTGCAGG + Intronic
969627165 4:8311568-8311590 TTTGGGGAGAGGGCTGCTGATGG + Intergenic
969976597 4:11108569-11108591 CTTGGGGGTGGGGCCTTTGCTGG + Intergenic
970007563 4:11426354-11426376 GTTGGGGGGGGGGCCTCTGAAGG - Intronic
970195128 4:13544622-13544644 TTCGGGGGGAGGGGGTCTCCGGG - Exonic
970248856 4:14093202-14093224 TTGAGGGGGAGGGAGTCTGCAGG - Intergenic
970848719 4:20575567-20575589 TTTGAGGTGGGGGCCTCTGCTGG + Intronic
971386125 4:26141869-26141891 TTTGGGGGAAGGGGCTCTGAAGG - Intergenic
971502117 4:27328674-27328696 CTTGGGGGTAGGGCCTTTGCTGG + Intergenic
972637760 4:40899443-40899465 TTTAGGGAGAGGTCCTCTGCAGG - Intronic
974603693 4:64122302-64122324 GTGGGGGAGAGGGTCTCTGCTGG + Intergenic
976767338 4:88610959-88610981 CCTGTGGGGAGGGCGTCTGCAGG - Intronic
976774929 4:88697789-88697811 CTCGGGTGCAGGGCCTCTGCGGG - Exonic
978204446 4:106063692-106063714 TTAGGAGGGAGGGCCTTTGGGGG + Intronic
984718873 4:182951973-182951995 CTTGGGGGTAGGGCCTTGGCTGG + Intergenic
985543677 5:498771-498793 TTTGGGAAGAGTGCCCCTGCTGG + Intronic
985864405 5:2503101-2503123 TCTGTGGGGAGGCCCTCTGCTGG - Intergenic
985872426 5:2568186-2568208 TTTTGGGGGTGGGACTCTGATGG - Intergenic
987710391 5:21496360-21496382 TTGGGTGGGAGGGCTTCTCCAGG + Intergenic
991737474 5:69641006-69641028 TTGGGTGGGAGGGCTTCTCCAGG - Intergenic
991760719 5:69915419-69915441 TTGGGTGGGAGGGCTTCTCCAGG + Intergenic
991786612 5:70202682-70202704 TTGGGTGGGAGGGCTTCTCCAGG - Intergenic
991789050 5:70220732-70220754 TTGGGTGGGAGGGCTTCTCCAGG - Intergenic
991813800 5:70495838-70495860 TTGGGTGGGAGGGCTTCTCCAGG - Intergenic
991816930 5:70517122-70517144 TTGGGTGGGAGGGCTTCTCCAGG - Intergenic
991839949 5:70790470-70790492 TTGGGTGGGAGGGCTTCTCCAGG + Intergenic
991879056 5:71203067-71203089 TTGGGTGGGAGGGCTTCTCCAGG - Intergenic
991881496 5:71221096-71221118 TTGGGTGGGAGGGCTTCTCCAGG - Intergenic
995782802 5:115795903-115795925 TTTGGTGTGAAGGCCACTGCTGG - Intergenic
997760796 5:136445900-136445922 TTTGGGGGTGGGGGCTCTCCTGG - Intergenic
1002059699 5:176619256-176619278 GGTGGGGGCGGGGCCTCTGCGGG + Intergenic
1003133784 6:3417446-3417468 TTTGGGGAGAAGGGCACTGCTGG + Intronic
1007428978 6:41765465-41765487 TCTGGGAGGAGGGTCTCTGCTGG - Intergenic
1012373031 6:98529963-98529985 TGTGTGGGGGGGTCCTCTGCGGG - Intergenic
1013774293 6:113662273-113662295 ATTGGGAGGAGGGCTTCTTCTGG - Intergenic
1016742731 6:147545558-147545580 TTTGGGGGCAGGGGCTGTGGGGG + Intronic
1017826706 6:158086967-158086989 TTGGAGGGGGGGGTCTCTGCGGG - Exonic
1018126772 6:160690247-160690269 TTTGGAGGCAGGGCCTTTGGAGG - Intergenic
1018149780 6:160926846-160926868 TTTGGAGGCAGGGCCTTTGGAGG + Intergenic
1019135904 6:169907591-169907613 GTAGAGGGGAGGGCCTCTGGGGG + Intergenic
1019347358 7:537660-537682 TTTTGGGGGGGGGACTCTTCAGG - Intergenic
1022019259 7:26382568-26382590 TTTGGGGTGAGGTCCCCTGAAGG - Intergenic
1022341928 7:29476737-29476759 CTTAGGGGGAGGGGCTCTACTGG + Intronic
1023915013 7:44582176-44582198 TGTCGGGGCTGGGCCTCTGCGGG - Exonic
1026445688 7:70482614-70482636 TTTGGGGGGAGGGCCTCTGCAGG + Intronic
1026672448 7:72401982-72402004 TTTGGTGGAAGGTCCTCTCCTGG + Intronic
1027172912 7:75885495-75885517 TTTGGGGGGAGGACCACTGAAGG - Intronic
1027909354 7:84229075-84229097 TTTAGTGTGAGTGCCTCTGCTGG - Intronic
1029675604 7:102066350-102066372 TTTGGAGCTAGGGTCTCTGCAGG - Intronic
1030077477 7:105748926-105748948 TTTGGGGGAAGGCCCTCTGCTGG + Intronic
1031448203 7:121881074-121881096 TTTGGGGACAGGGCCTTTGCAGG + Intronic
1032020809 7:128406271-128406293 TGGGGGGGTGGGGCCTCTGCTGG - Intronic
1033125711 7:138705418-138705440 TTTGGAGGGAGGGCCGCCCCCGG - Intergenic
1035333905 7:158113563-158113585 CTTGGGGAGAGGACCTCAGCAGG + Intronic
1035824726 8:2631964-2631986 CTTGGGGGTAGAGCCTTTGCTGG + Intergenic
1035887448 8:3307314-3307336 TTAGGTGTGAGGGCCTCAGCTGG - Intronic
1036581491 8:10079621-10079643 TGTGCGGGGAGGGACACTGCGGG - Intronic
1038948793 8:32391125-32391147 TTTGGGGGGAGGGGGGCTGGTGG + Intronic
1045235756 8:100351344-100351366 GATGTGGGGAGCGCCTCTGCCGG + Intronic
1045481236 8:102593829-102593851 CTTGAGGGTAGGGCCTTTGCTGG - Intergenic
1049725155 8:144142363-144142385 TGTGGGGTGTGGGCCCCTGCAGG + Intergenic
1049747140 8:144267737-144267759 CTGGGGGTGAGGGCCCCTGCAGG + Intronic
1053167207 9:35853275-35853297 TGTGGGGGGAGGGTCCCAGCAGG + Intronic
1057227283 9:93299085-93299107 CTTAGCGGGAGGGCCTCTGCTGG - Exonic
1060894311 9:127207904-127207926 TGCGGGTGGAGGGCCTGTGCCGG - Intronic
1061087761 9:128409228-128409250 GTTGGGGGGAGGGGGTCAGCGGG + Intergenic
1062206513 9:135340552-135340574 TTTGGGGGCAGTGCAGCTGCGGG - Intergenic
1062332217 9:136049792-136049814 CCTGGGGGTAGGGCATCTGCTGG + Exonic
1062497211 9:136837548-136837570 GGTGGGGGCAGGGCCTCTGAGGG - Exonic
1185519201 X:725353-725375 TGGGTGGGGAGGGTCTCTGCAGG - Intergenic
1189286387 X:39854948-39854970 TTTGGGGGAGGGCCCTCTTCTGG - Intergenic
1191065940 X:56348021-56348043 GTTGGGGGGAGGGGGTCTGGGGG - Intergenic
1195757001 X:108208899-108208921 TTTGGGGAGAGGGCATTTGGTGG - Intronic
1198495979 X:137193939-137193961 TATGGGGAGAGGTCCTCTCCTGG - Intergenic
1200067124 X:153509303-153509325 TTTGGGGGCAAGGCCTGAGCAGG - Exonic
1200793770 Y:7322202-7322224 TTTGGTGGAATGGCCTGTGCTGG + Intergenic
1202369611 Y:24187929-24187951 GCTGTGGTGAGGGCCTCTGCTGG + Intergenic
1202501174 Y:25482188-25482210 GCTGTGGTGAGGGCCTCTGCTGG - Intergenic