ID: 1026446198

View in Genome Browser
Species Human (GRCh38)
Location 7:70486988-70487010
Sequence CTGTAGGCATGGTGGTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026446190_1026446198 -7 Left 1026446190 7:70486972-70486994 CCCACAGGGCCTTTCCCTGTAGG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1026446198 7:70486988-70487010 CTGTAGGCATGGTGGTAAACTGG No data
1026446192_1026446198 -8 Left 1026446192 7:70486973-70486995 CCACAGGGCCTTTCCCTGTAGGC 0: 1
1: 0
2: 0
3: 30
4: 259
Right 1026446198 7:70486988-70487010 CTGTAGGCATGGTGGTAAACTGG No data
1026446189_1026446198 -6 Left 1026446189 7:70486971-70486993 CCCCACAGGGCCTTTCCCTGTAG 0: 1
1: 0
2: 2
3: 29
4: 304
Right 1026446198 7:70486988-70487010 CTGTAGGCATGGTGGTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026446198 Original CRISPR CTGTAGGCATGGTGGTAAAC TGG Intronic
No off target data available for this crispr