ID: 1026449268

View in Genome Browser
Species Human (GRCh38)
Location 7:70513060-70513082
Sequence TTTAACAGATCTGCGTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026449264_1026449268 22 Left 1026449264 7:70513015-70513037 CCTACTCAGCTTTAAGCACTCAA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 1026449268 7:70513060-70513082 TTTAACAGATCTGCGTAATGGGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026449268 Original CRISPR TTTAACAGATCTGCGTAATG GGG Intronic
906494876 1:46297970-46297992 GTTAACAGATGTGTCTAATGAGG + Intronic
911030776 1:93485192-93485214 TTTCACAGTTCTTTGTAATGTGG - Intronic
913377466 1:118168953-118168975 TTTCACAGCTCTGCCTAATGTGG - Intronic
920775959 1:208937446-208937468 TTTAACAGATATGGGAAAAGGGG + Intergenic
923510133 1:234643900-234643922 TTTTACAGATCTGCAAACTGAGG + Intergenic
1070222178 10:74459336-74459358 TTTAACAGATTTCTTTAATGTGG + Intronic
1073658569 10:105446423-105446445 TTTCACTGTTCTGTGTAATGTGG + Intergenic
1073914950 10:108391881-108391903 TTTAACAGATGTGATTACTGAGG - Intergenic
1079458233 11:20655270-20655292 TTGAACAGAACTGAGCAATGTGG + Exonic
1081473217 11:43396850-43396872 TTTAACAGTCCTGAGGAATGTGG - Intronic
1085361318 11:75890137-75890159 TTTAAAAGTTCTGCGTGCTGTGG - Intronic
1088426160 11:109706095-109706117 TTTTACAGAGCTGTGTAATATGG + Intergenic
1089828064 11:121297235-121297257 TTTTAGAAATCTGCCTAATGAGG + Intronic
1097915201 12:65013798-65013820 TTTAGCACATCTGCGTAGTAAGG - Intergenic
1108310406 13:49184091-49184113 TTAAACAGATCTGAGTAACAAGG + Intronic
1110055799 13:70968980-70969002 CTTAACAGATCTGCATGATAGGG + Intergenic
1113610686 13:111642792-111642814 TTTTACAGATCTGTGAAGTGGGG + Intronic
1121547661 14:94773710-94773732 TTTTACAGTTATGCGGAATGGGG - Intergenic
1125241826 15:37585021-37585043 TTTAACAGTTGTGTGGAATGTGG - Intergenic
1125818359 15:42606189-42606211 TTTTACAGATGTGCTTACTGAGG + Intronic
1128215896 15:65933827-65933849 TTTAACAGATGTGGGAACTGAGG - Intronic
1128698904 15:69789710-69789732 TTTCACAGATGTGCGGACTGAGG + Intergenic
1129364961 15:75048545-75048567 CTTCACAGACCTGCGTCATGCGG + Exonic
1131893320 15:96998133-96998155 TTTCACAGATCTTCATAAAGAGG + Intergenic
1132306874 15:100821572-100821594 TTTAACAAATATGATTAATGTGG - Intergenic
1133776421 16:8898944-8898966 TTTAACATCTCAGAGTAATGTGG + Intronic
1133871245 16:9688365-9688387 TTTAACTCATCTGCAAAATGGGG + Intergenic
1138950412 16:61906090-61906112 TTTCACAACTCTGTGTAATGTGG - Intronic
1142103657 16:88290422-88290444 GATAACAGATCTGCTTAAGGAGG - Intergenic
1144022363 17:11248733-11248755 TTTATAAGGTCTGAGTAATGCGG + Intronic
1146951728 17:36911172-36911194 TTTTACTCATCTGCGGAATGGGG - Intergenic
1150578180 17:66448453-66448475 TTAAACTGCTATGCGTAATGAGG + Intronic
1153608422 18:6857153-6857175 TTTAACAGCTATGGGTGATGGGG - Intronic
1153982549 18:10322566-10322588 TTTTTCAGATCTGTGGAATGGGG - Intergenic
1155224333 18:23715531-23715553 TTTAAGAGTTCTGCTCAATGGGG + Intronic
1156863437 18:41864339-41864361 TTTATCAGAGCTGCGTAAGGTGG + Intergenic
1158028467 18:52932687-52932709 TTGAACACATCTGTGTAAGGTGG - Intronic
1158175665 18:54653164-54653186 TTTAAAAGATCTGCGTAACTCGG + Intergenic
1158402567 18:57134109-57134131 TTTAACAGATGTGCAAACTGAGG - Intergenic
1160355203 18:78221867-78221889 TTTAAGAGATCTGTGAAATGAGG - Intergenic
1162186834 19:8912024-8912046 TTTGACAAATCTGAGCAATGGGG + Intronic
1165315142 19:35050438-35050460 TTTTACAGATGTGCAAAATGAGG + Intronic
1167196239 19:48030802-48030824 TTTAATAGATCTACCTCATGAGG + Intronic
1167490105 19:49787828-49787850 TGTCACAGATTTGCCTAATGTGG + Intronic
927179755 2:20436601-20436623 TTTAGCAAATCTGCAAAATGAGG + Intergenic
930002956 2:46873598-46873620 TTCACCAGATCTGTGCAATGGGG - Intergenic
930647711 2:53929376-53929398 TTTACCTGATCTGGGCAATGTGG - Intronic
931756541 2:65379643-65379665 TTTTATAGATGAGCGTAATGAGG + Intronic
935056156 2:99569008-99569030 TTTAAAAACTCTGCTTAATGCGG + Intronic
939374009 2:141340607-141340629 TTTAAGTGATCTCTGTAATGAGG + Intronic
939541354 2:143497968-143497990 TCTAACACATCTGCTGAATGGGG - Intronic
940834159 2:158501705-158501727 TTTCACAGATCTGTGAAATTTGG - Intronic
944045691 2:195408979-195409001 TTTTACACATCTGTGAAATGGGG - Intergenic
945181975 2:207101349-207101371 TTTGATAGATGTGTGTAATGTGG + Intronic
945259029 2:207827190-207827212 TTTAAAAAATCAGAGTAATGTGG - Intergenic
945794360 2:214343390-214343412 TTTAACACACATGAGTAATGAGG + Intronic
946501110 2:220248223-220248245 TTTAACATCTATGCTTAATGTGG + Intergenic
1171035723 20:21711109-21711131 TTTAAGTGATTTGTGTAATGTGG - Intronic
1173951763 20:46998952-46998974 ATTTACAGGTCTGCGTAGTGGGG + Intronic
1174186464 20:48709584-48709606 TTTAACAGATGGGCGGACTGAGG + Intronic
1174973064 20:55299782-55299804 TTTTACAGATCTGCCTATTCCGG - Intergenic
1177086075 21:16706353-16706375 TTTAATATATCTGCATAATATGG - Intergenic
950793265 3:15490337-15490359 TTCAACAGATCTCCATAAGGTGG + Intronic
955937147 3:64112920-64112942 TTTAACAGATCTTCAGAAGGAGG + Intronic
957489992 3:80911246-80911268 TTTATCAGATCTGAGTAATGTGG + Intergenic
959866948 3:111281811-111281833 TTTCACAGATCTGAGAAACGTGG + Intergenic
966347806 3:178998408-178998430 TTTCCCAGATCTGGGCAATGGGG - Intergenic
966389134 3:179433194-179433216 TTTATCAGATCTGTGTTATTGGG - Intronic
967045051 3:185728635-185728657 TTGAACAGATTTGCTTAGTGAGG + Intronic
968944672 4:3657438-3657460 TTTTACAGATCAGCGAAGTGAGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
982369935 4:154623811-154623833 TTTAACAGGTTTGCGTGGTGAGG - Intergenic
984948823 4:184990815-184990837 TTTAACAAATCTGTGGATTGGGG - Intergenic
986050769 5:4088183-4088205 TTTAACAGACTTGGGAAATGTGG + Intergenic
995301326 5:110587133-110587155 TTTAGCAGATCAACATAATGAGG + Intronic
995822369 5:116251222-116251244 TTTGAAAAATCTGTGTAATGGGG - Intronic
996866591 5:128130946-128130968 TTTAACTGCTCTGCTTATTGGGG + Intronic
1000574326 5:162957519-162957541 TTTAACAGATCAGAGAAATGAGG - Intergenic
1000784033 5:165521106-165521128 TTTAAAAACTCTCCGTAATGAGG + Intergenic
1006815618 6:36847932-36847954 TTTTACAGATCTGGGAACTGAGG + Intergenic
1009409114 6:63345241-63345263 TTTAACAGATTTTAGTAAGGTGG + Intergenic
1015869499 6:137761566-137761588 TTTAAAAAATCTGTGTAATCAGG + Intergenic
1017000523 6:149993968-149993990 TTCAACAGAAATGAGTAATGGGG - Intergenic
1017524782 6:155232931-155232953 TTTAAAAGTGCTGCGTAATTTGG - Intronic
1017621795 6:156306851-156306873 TTTACCAGTTCTGTGAAATGAGG - Intergenic
1017709317 6:157152229-157152251 TTTTACACAGCTGCTTAATGTGG - Intronic
1018988787 6:168657869-168657891 TTTAAGAGGTCTGCATCATGAGG - Intronic
1019009660 6:168833849-168833871 TTTAACATCACTACGTAATGTGG - Intergenic
1023360305 7:39408703-39408725 TTTAACACATGTGCCCAATGGGG + Intronic
1026449268 7:70513060-70513082 TTTAACAGATCTGCGTAATGGGG + Intronic
1028502872 7:91538529-91538551 TTTAACACATCTGTATCATGGGG - Intergenic
1030463361 7:109868675-109868697 ATTAACTGATCTTCCTAATGAGG - Intergenic
1030640154 7:111995789-111995811 TTTAGCAGCACTGCGAAATGAGG - Intronic
1037266264 8:17064320-17064342 TTTAGAAGAACTGAGTAATGTGG + Intronic
1043123083 8:76355535-76355557 TTTTTCAGTTCTGCTTAATGTGG - Intergenic
1049961281 9:740784-740806 TTTTACAGATGTGTGTAATGTGG + Exonic
1050494153 9:6222094-6222116 TTTAACAGAACTGCCTTGTGCGG - Intronic
1051893603 9:21967016-21967038 TTTAACAGGTATGCTTAATGGGG + Exonic
1054985526 9:71257905-71257927 TTTATCAGATATGCAAAATGGGG + Intronic
1056605565 9:88082146-88082168 TTTAACATATCTTCATAATAAGG + Intergenic
1058091579 9:100811836-100811858 TTTTACAGGTCTGGCTAATGCGG + Intergenic
1059835191 9:118144011-118144033 TTTAACAGATGTACATACTGAGG - Intergenic
1186624627 X:11279817-11279839 TTTAACAGATGAGCCAAATGAGG + Intronic
1187965550 X:24607883-24607905 GTTAACAGAACTGCAGAATGAGG + Intronic
1188521965 X:31048363-31048385 TTTTACAGATCAGGATAATGAGG + Intergenic
1191833013 X:65435127-65435149 TTTAACAGTTTTGCATGATGAGG + Intronic
1197856321 X:130917370-130917392 TTTAACTTATCTGCAAAATGGGG - Intergenic
1200769942 Y:7114921-7114943 TTTAACAGATCACAGAAATGAGG - Intergenic