ID: 1026449485

View in Genome Browser
Species Human (GRCh38)
Location 7:70514946-70514968
Sequence CTCAATAAAAATATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1303
Summary {0: 1, 1: 0, 2: 25, 3: 154, 4: 1123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026449485_1026449488 25 Left 1026449485 7:70514946-70514968 CCTTTGTCCATATTTTTATTGAG 0: 1
1: 0
2: 25
3: 154
4: 1123
Right 1026449488 7:70514994-70515016 GTAAAGCTCTTTATATACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026449485 Original CRISPR CTCAATAAAAATATGGACAA AGG (reversed) Intronic
901377619 1:8850762-8850784 CTCAATTCAAAAATGGGCAAAGG + Intergenic
901403082 1:9027673-9027695 GTCAATAAAATATTGGACAAAGG + Intergenic
902660688 1:17900653-17900675 CTCAATTAAAAAATGGGCAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902826511 1:18978381-18978403 CCCAATTACAAAATGGACAAAGG - Intergenic
903102143 1:21039827-21039849 CCCAATTAAAAAATGGGCAAAGG + Intronic
903748761 1:25605521-25605543 CTCAATTAAAAAATGGGCAAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904637554 1:31895177-31895199 CCCACTAAAAAAATGGGCAAAGG + Intergenic
905459106 1:38110244-38110266 CTCATTAGAAAAATGGGCAAAGG + Intergenic
905486950 1:38306338-38306360 ATCAATAAAAATCAGGATAATGG - Intergenic
905593162 1:39182522-39182544 CCCAATAAAAAAATGGGCAAAGG + Intronic
906664618 1:47611238-47611260 CTCAATAGAAAAATTGGCAAAGG + Intergenic
906736442 1:48133684-48133706 CCCCATCAAAAGATGGACAAAGG - Intergenic
906815608 1:48875194-48875216 CCCAAGAAAAATATGGGAAAAGG + Intronic
906850340 1:49242242-49242264 ATCAATAAAAATATGTTAAATGG + Intronic
906926650 1:50124949-50124971 CTCAACAAAAATTTGAAGAATGG - Intronic
907025634 1:51115385-51115407 CTCAATAAAACAATGAACTATGG - Intronic
907180219 1:52563110-52563132 GTCAATAAAAATGTGAAAAATGG + Intergenic
907295175 1:53446564-53446586 CTCAATAAAAATCTGTTGAATGG - Intergenic
907701593 1:56793446-56793468 CTCCATTAAAAAATGGACAAAGG + Intronic
907957688 1:59246454-59246476 CCCAATCAAAAAGTGGACAAAGG - Intergenic
908105751 1:60840152-60840174 TCCAATTAAAATATGGGCAAAGG + Intergenic
908223049 1:62027806-62027828 CTCATTAAAAAAATGGGCAAGGG - Intronic
908365966 1:63424139-63424161 CTCAAAAAAAAAATAGGCAAAGG - Intronic
908694381 1:66821673-66821695 TTAAATAAAAAAATGGGCAATGG - Intronic
909423754 1:75496800-75496822 CCAATTAAAAATATGGGCAAAGG + Intronic
909661460 1:78087921-78087943 CTCCATTAAAAAGTGGACAAAGG + Intronic
909817848 1:80018772-80018794 CACAATAGGAATATGGTCAATGG - Intergenic
910331464 1:86077161-86077183 CTCCATCAAAATGTGGGCAAAGG + Intronic
910419474 1:87042145-87042167 CTCAATTAAAAAATGGGCAAAGG - Intronic
910610544 1:89136947-89136969 CACAATAAAAAAATGGCAAAAGG + Intronic
910824245 1:91388957-91388979 CCCAATTAAAATATGGACAAAGG + Intronic
910850632 1:91646761-91646783 GTCAATAAAAAAATGAGCAAAGG - Intergenic
910977490 1:92922197-92922219 TTCAATAAAACTATAGATAAAGG - Intronic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
911675935 1:100658219-100658241 CTTTATAAAAACATGGACTAGGG - Intergenic
911992981 1:104726230-104726252 CACAATTATAAAATGGACAAAGG + Intergenic
912594692 1:110862612-110862634 CCCAATAAAAAAGTGGGCAAAGG - Intergenic
912749234 1:112271895-112271917 CTCAATCAAAAGATGGACATTGG - Intergenic
912848805 1:113103518-113103540 CTCAATAGATATAGGGACCACGG - Intronic
913374316 1:118133656-118133678 CTCAAGGGAAATATGAACAAGGG - Intronic
914325340 1:146609442-146609464 CACAATAGAAAAATGGGCAAAGG - Intergenic
914948845 1:152092027-152092049 TTCAATAAATTTATGGAAAATGG + Intergenic
915071024 1:153267273-153267295 CCCAATTAAAAAATGGGCAAAGG - Intergenic
915153166 1:153851601-153851623 ATTAAAAAAAAAATGGACAAAGG - Intronic
916593245 1:166214072-166214094 CTCAATAAAAAAATGATAAAGGG - Intergenic
917002816 1:170378777-170378799 CTCAATTCAAAAATGGGCAAAGG - Intergenic
917042068 1:170816080-170816102 CCCCATCAAAAAATGGACAAAGG + Intergenic
917081931 1:171264541-171264563 CTCACTCAAAATATGGTCCATGG + Intronic
917408010 1:174729639-174729661 CCCATTTAAAAAATGGACAAAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917766586 1:178226415-178226437 CACAATAAAAACAGGGAAAATGG - Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
917826618 1:178828588-178828610 CCCAATTAAAAAATGGGCAAAGG + Intronic
918219212 1:182420604-182420626 CCCTATTAAAATGTGGACAAAGG - Intergenic
918420330 1:184358247-184358269 CTCAATAGAAAGATTGGCAAAGG + Intergenic
918500973 1:185195759-185195781 GTCAACAAACATATGGAAAAAGG - Intronic
918636909 1:186787462-186787484 CTCAACAGAAATATGGGTAAAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918773736 1:188600330-188600352 CTCAATAAAAAAATTGTTAAAGG - Intergenic
918818566 1:189224234-189224256 TTCAATTAAAAGATAGACAAAGG + Intergenic
918911879 1:190583729-190583751 CTCAATAGAAATGTTGAGAAAGG + Intergenic
918933266 1:190885155-190885177 CTCAATAAAACTATTAAAAATGG + Intergenic
919082281 1:192880893-192880915 TTCAAGAAAAATATAGATAATGG + Intergenic
919553394 1:199021714-199021736 AGCAATAAAATTATGGAAAATGG + Intergenic
919965012 1:202514257-202514279 CCCAATTAAAAAATGGGCAAAGG - Intronic
920153622 1:203930200-203930222 CCCAATTAAAAAATGGGCAAGGG + Intergenic
920410607 1:205757233-205757255 CCCAAATAAAAAATGGACAAAGG - Intergenic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
920608131 1:207410124-207410146 CCCCATTAAAATATGGACAAAGG + Intergenic
921057898 1:211558017-211558039 CTCAATTAAAAAATGGGCAAAGG + Intergenic
921241662 1:213190475-213190497 CTAATTTAAAACATGGACAAAGG - Intronic
921312994 1:213863072-213863094 CCCTTTAAAAATCTGGACAAAGG + Intergenic
921337064 1:214098944-214098966 CGAAATAAAAATATGGATTAGGG - Intergenic
921389380 1:214603701-214603723 CTCAATAAAACAAAGGACCAGGG - Intronic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
921675050 1:217967702-217967724 CTCCATTAAAAAGTGGACAAAGG - Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922384395 1:225067774-225067796 CTCAATAAAAAAGTGGGTAAAGG - Intronic
922543943 1:226441024-226441046 CTCAATAGAAATAGAGGCAAAGG - Intergenic
922631508 1:227118220-227118242 CTCAATCAAAAAATGGGCAAAGG + Intronic
923058248 1:230445899-230445921 CCCAATTAAAAAATGGGCAAAGG + Intergenic
923248580 1:232158259-232158281 CCCAATTAAAAAATGGGCAAAGG + Intergenic
923428857 1:233900518-233900540 CCCAATTAAAAAATGGACAAAGG + Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924296503 1:242592236-242592258 CTCTATCAAAATGTGGGCAAAGG + Intergenic
924309907 1:242729539-242729561 CCCAATTAAAGTATGGGCAAAGG - Intergenic
924652743 1:245945299-245945321 CCCATTAAAAAAATGGGCAAAGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062776967 10:158882-158904 CGCAATTAAAACATGGATAAAGG - Intronic
1062780043 10:194726-194748 CTCCATAAAAAAATGGGCAAAGG - Intronic
1063437096 10:6042693-6042715 CCCAATAAAAATAGGGACAAAGG + Intronic
1063621477 10:7652868-7652890 CACAATAGAAAGATGGGCAAAGG + Intronic
1063858051 10:10276894-10276916 CCCAATTAATACATGGACAAAGG - Intergenic
1064163762 10:12969123-12969145 GTCAATTAAAAAATGGGCAAAGG + Intronic
1064319453 10:14289448-14289470 CCCAATTAAAAACTGGACAAAGG - Intronic
1064772357 10:18736482-18736504 CCCATTAAAAAAATGGACAAAGG + Intergenic
1064845659 10:19649555-19649577 CTCCATTAAAAAGTGGACAAAGG - Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1065120126 10:22521352-22521374 CTCCATCAAAAAGTGGACAAAGG - Intergenic
1065410845 10:25425816-25425838 CACAATAAAAATATAGAAAAAGG - Intronic
1065439228 10:25732650-25732672 CCCAATTAAAAAATGGACAAAGG - Intergenic
1065491130 10:26282822-26282844 AGTAATAAAAATATGGACACAGG + Intronic
1065756054 10:28932180-28932202 CTCAATAAAAAAATAAAAAAAGG + Intergenic
1065906425 10:30256973-30256995 CCCTATTAAAAAATGGACAAGGG - Intergenic
1066166553 10:32794748-32794770 CCCCATTAAAATATGGGCAAAGG - Intronic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066594248 10:37031710-37031732 CCTAATTAAAATATGGGCAAAGG - Intergenic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067072755 10:43147312-43147334 CTCAATTAAAATGTGGGAAAAGG - Intronic
1067174385 10:43932666-43932688 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1067195843 10:44117243-44117265 CTCACCAAAAAAAGGGACAATGG + Intergenic
1067413657 10:46086766-46086788 CCCAATTAAAAAATGGACAGAGG - Intergenic
1067676178 10:48379603-48379625 CTCAAAAAAAATGTGGACTCTGG + Intronic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068137902 10:52968827-52968849 CTCAATGAACATATGTACAGGGG + Intergenic
1068387119 10:56345083-56345105 CTCAATGAAAATATGAGCAAAGG + Intergenic
1068531551 10:58193263-58193285 CTCAATCAAAATACAGACGAAGG + Exonic
1068864173 10:61877737-61877759 CTTAATAAAGATTTGGTCAAAGG - Intergenic
1069298195 10:66873539-66873561 CTCCATTAAAAAATGGACAGAGG - Intronic
1069473808 10:68715691-68715713 CTCAAAAAAAAAAAGGAAAAAGG - Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070058485 10:72957881-72957903 CCCAATTGAAAAATGGACAAAGG - Intergenic
1070082067 10:73198824-73198846 TTCAATTGAAAAATGGACAAAGG + Intronic
1070357014 10:75649943-75649965 CTCAATTCAAAAATGGGCAAAGG - Intronic
1070429377 10:76321498-76321520 ATCAATAGAAAAATAGACAAAGG - Intronic
1070435941 10:76393487-76393509 CCCAATTAAAATATGGGCAAAGG - Intronic
1070480420 10:76877060-76877082 CCCTTTAAAAATATGAACAAAGG + Intronic
1070808160 10:79282991-79283013 CTCATTAAAAATCTGGAAGAAGG - Intronic
1070941041 10:80347250-80347272 CCCAATTAAAAAATGGGCAAAGG - Intronic
1071001721 10:80838600-80838622 CACAATAAAAAAATGGTAAAAGG - Intergenic
1071380150 10:85051212-85051234 CTCATTAAAAAAGTGGGCAAAGG + Intergenic
1071542157 10:86495811-86495833 CTCAATTCAAAAATGGGCAAAGG + Intronic
1072264831 10:93717252-93717274 CCCAATTCAAATATGGGCAAAGG - Intergenic
1072266687 10:93736078-93736100 CTGAATTAAATTATGGCCAATGG + Intergenic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1074210318 10:111326674-111326696 CTCCATTAAAAACTGGACAAAGG - Intergenic
1074617965 10:115089369-115089391 TTCAATAAAAATATGGGCTAGGG - Intergenic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1074844139 10:117382056-117382078 CTCAAAAAAAAAATAGGCAAAGG - Intergenic
1075278413 10:121116779-121116801 CTCAATTAAAAAGTGGGCAAAGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075857867 10:125645802-125645824 CTAAAAAAAAATATGTAAAAGGG + Intronic
1076320177 10:129573775-129573797 ACCAAAAAAAATATGGTCAAGGG - Intronic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1076592387 10:131593005-131593027 CACAATTAAAAAATAGACAAAGG - Intergenic
1076592704 10:131597705-131597727 CACAATTAAAAAATAGACAAAGG - Intergenic
1077204315 11:1334929-1334951 CTCAATTAAAAAATGGCAAAGGG - Intergenic
1077470138 11:2753979-2754001 CCCAATTAAAAAATGGGCAAAGG + Intronic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1078316449 11:10297027-10297049 ATCAATTAAAAAATGGGCAAAGG - Intergenic
1078342115 11:10505111-10505133 CTGAATAAAAATCTAGACTATGG + Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078612075 11:12829609-12829631 CTCAATAAATACATGGATAAAGG - Intronic
1079022440 11:16920473-16920495 ATCCATCAAAATATGGACAGTGG + Intronic
1079925999 11:26492012-26492034 ATCAATCATAATAAGGACAAGGG + Intronic
1080325865 11:31072266-31072288 TTCAATACAAAAATGGGCAAAGG - Intronic
1080340316 11:31255650-31255672 TTCAATTAAAAAATGGGCAAAGG - Intronic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG + Intronic
1081349633 11:42034676-42034698 CTCAATAAAAGTATAGACTTTGG - Intergenic
1081685141 11:45037049-45037071 TTCACTAAAAATATGAACTAAGG + Intergenic
1081763572 11:45593724-45593746 CTCAATAGGAATATGGGCAATGG + Intergenic
1082245075 11:49911946-49911968 CTCAATCAAAAAGTGGGCAAAGG - Intergenic
1082565344 11:54670895-54670917 CTCAATCAAAAAGTGGACAAAGG + Intergenic
1082668159 11:56001136-56001158 CTCCATTAAAACATGCACAAAGG - Intergenic
1082886252 11:58086180-58086202 CCCAATTAAAACATGGACAAAGG + Intronic
1082887790 11:58106318-58106340 TACAATTAAAAAATGGACAAAGG - Intronic
1084467936 11:69337820-69337842 CTCAGTAAATATATGGACAATGG - Intronic
1084541901 11:69792278-69792300 CTCAACAAGAATGTGGACAAGGG + Intergenic
1084576362 11:69990789-69990811 CTCAATTAGAAAATAGACAAAGG - Intergenic
1084710144 11:70839218-70839240 CTAAATAAAACTAAGGACAATGG + Intronic
1084850636 11:71936897-71936919 CTCAATAAATATATGGATATGGG - Intronic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1085139521 11:74128209-74128231 CCAATTAAAAATATGGGCAATGG - Intronic
1085343208 11:75747332-75747354 CCTAATTAAAAAATGGACAAAGG + Intergenic
1085377613 11:76080458-76080480 CTCAATAAAAATAAATAAAAAGG - Intronic
1085453414 11:76652209-76652231 CTCAGTAGAAAAATGGGCAAAGG + Intergenic
1085842827 11:80032598-80032620 CTCAATTAAAAAATGGACTAGGG + Intergenic
1085894216 11:80618164-80618186 CCCAATTAAAATATGGGCAAAGG + Intergenic
1085960500 11:81456069-81456091 CTCCATCAAAAAGTGGACAAAGG + Intergenic
1086040079 11:82465723-82465745 CTCAATAAATATTTGTAAAATGG + Intergenic
1086056938 11:82658052-82658074 CTCTATAAAAAAATGGGCAAAGG + Intergenic
1086163135 11:83745896-83745918 CTCCATCAAAAAGTGGACAAAGG + Intronic
1086461497 11:87010264-87010286 TCCAATTAAAAAATGGACAAAGG + Intergenic
1086468336 11:87078397-87078419 CCCAATTAAAACATGGGCAAAGG - Intronic
1086538120 11:87874403-87874425 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087514920 11:99146363-99146385 TTAAATGAAAATATGAACAAAGG - Intronic
1087808628 11:102584451-102584473 CTCAGTTAAAATATGGGCAAAGG - Intronic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088497329 11:110443891-110443913 CTCATTAAAAAAATAGGCAAAGG - Intronic
1088511076 11:110575481-110575503 CTCAATAAAAAAAGGAGCAATGG + Intergenic
1088520787 11:110697402-110697424 CTCCATTAAAAAATGGGCAAAGG - Intronic
1088627363 11:111739176-111739198 CTCAATAAAAATGTGTTCAATGG - Intronic
1089143991 11:116311095-116311117 CTCCTTAAAAATATCGACAAGGG + Intergenic
1089416277 11:118294401-118294423 CCCAATAAAAAATTGGGCAAAGG - Intergenic
1089677759 11:120101485-120101507 CTCAATTAGAATATGGGCAAAGG - Intergenic
1089906282 11:122043014-122043036 CCAAATAAAAATAAGGAAAAAGG - Intergenic
1090525788 11:127534053-127534075 CTCAACTAAAATATGGGCAGAGG - Intergenic
1090602196 11:128384757-128384779 CTCAAAAAAAATATAGGCTAGGG + Intergenic
1090866827 11:130708579-130708601 CCCAATTAAAAAACGGACAAAGG + Intronic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092516478 12:9219788-9219810 CACCATAAAAATGTGGGCAAAGG + Intergenic
1092550272 12:9491079-9491101 GACAATAATAATATAGACAACGG + Intergenic
1092751214 12:11720888-11720910 CTCCATTAAAAAATGGGCAAAGG + Intronic
1093015856 12:14153864-14153886 CCCAATTAAAAAATGGATAAAGG + Intergenic
1093388518 12:18588412-18588434 CCCCATTAAAATGTGGACAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093655818 12:21693341-21693363 CCCCATTAAAAAATGGACAAAGG + Intronic
1094118594 12:26944329-26944351 CCCAATAAAATTAGGAACAAGGG - Intronic
1094347946 12:29491611-29491633 CTTAGAAAAAATATGGATAATGG + Intronic
1094521538 12:31195293-31195315 GACAATAATAATATAGACAACGG - Intergenic
1094784852 12:33836009-33836031 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1095039933 12:37429634-37429656 CTCTATATATATATGGAAAAGGG - Intergenic
1095039953 12:37430097-37430119 CTCTATATATATATGGAAAAGGG - Intergenic
1095302440 12:40600501-40600523 CTAATTAAAAATATGGGCAAAGG - Intergenic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095408686 12:41897649-41897671 CTAACAAAAAATATGGGCAAAGG + Intergenic
1095517125 12:43018592-43018614 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1095574341 12:43718196-43718218 CTTGATTAAAATATGGACAAAGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096036903 12:48480282-48480304 CTCAATTAAAAATTGGACAAAGG - Intergenic
1096064723 12:48730440-48730462 CTCTCGCAAAATATGGACAAAGG + Intergenic
1096908147 12:54955302-54955324 CCAATTAAAAAAATGGACAAAGG + Intronic
1096937514 12:55298804-55298826 CTCAATTAGAAAATGGGCAAAGG - Intergenic
1097370352 12:58771238-58771260 CTCCATTAAAAAGTGGACAAAGG + Intronic
1097424440 12:59425213-59425235 ATGAATAACAATATGAACAATGG - Intergenic
1097718101 12:62989001-62989023 TTCTTTGAAAATATGGACAATGG - Intergenic
1097753318 12:63381995-63382017 CCCCATCAAAAAATGGACAAAGG + Intergenic
1097798961 12:63891647-63891669 TTCAGTAAAAATACTGACAAAGG + Intronic
1097903236 12:64893781-64893803 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1098547355 12:71726533-71726555 CTCAAAAAAAAAAAGAACAAAGG + Intergenic
1098631978 12:72734556-72734578 CTGAATGAAAATATGGACTGTGG - Intergenic
1098649469 12:72946280-72946302 TCCAATTAAAAAATGGACAAAGG + Intergenic
1098738655 12:74141706-74141728 AGCAATAAAAATATTGATAATGG - Intergenic
1098928662 12:76383215-76383237 CTCAATAAAAATTTCTATAAGGG + Intronic
1099032454 12:77544257-77544279 CCCCATTAAAAAATGGACAAAGG + Intergenic
1099076089 12:78111431-78111453 CCCAATAAAAATGTGGTCAAAGG + Intronic
1099253434 12:80286722-80286744 CACAATAAAAAAAATGACAAAGG - Intronic
1099626966 12:85087766-85087788 CTCCATCAAAAAGTGGACAAAGG - Intronic
1099688344 12:85918618-85918640 CCCAATTCAAAAATGGACAAAGG - Intergenic
1099966011 12:89445922-89445944 CCCAATCAAAAAATGGGCAAAGG + Intronic
1100135667 12:91550391-91550413 CCCCATAAAAATGTGGGCAAAGG + Intergenic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1101018167 12:100524225-100524247 CTCAAGAAAAAAATGGAAATAGG + Intronic
1101271995 12:103157295-103157317 CTCCATCAAAAAGTGGACAAAGG - Intronic
1101288322 12:103339510-103339532 GTCCATAAAAAAGTGGACAAAGG + Intronic
1101293100 12:103391584-103391606 CCCAATTAAAAAATGGGCAAAGG - Intronic
1101488198 12:105186909-105186931 CCCAATTAAAAAATGGACCAAGG - Intronic
1101993110 12:109503930-109503952 CTCAATAAATATTTGAAGAATGG - Intronic
1102592074 12:113964087-113964109 CCCATTAAAAATAAGGACACAGG + Intronic
1103130477 12:118464126-118464148 CTGAATAAATATTTGCACAATGG + Intergenic
1103430484 12:120880881-120880903 CCAAAAAAAAAAATGGACAAAGG + Intronic
1103504298 12:121431129-121431151 CTCAAAAAAAAAAAGCACAAAGG - Intronic
1103752670 12:123176378-123176400 ATCTGTAAAAATAAGGACAAGGG - Intronic
1103753874 12:123187331-123187353 CTCGAGAAAAAAATGAACAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105002552 12:132700498-132700520 CTCATTAAAAAAGTGGGCAACGG - Intronic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1105562929 13:21512270-21512292 CCCAATTAAAAACTGGACAAAGG - Intronic
1105835753 13:24210085-24210107 CTCAATCACAAAATGTACAAAGG - Intronic
1105861050 13:24413769-24413791 CTCAACAAAAATGTGGCCACAGG - Intergenic
1105952177 13:25239493-25239515 CCCAATTAAAAAATGAACAAAGG + Intergenic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106773547 13:32986447-32986469 CTCAATAATAATCTAGACCACGG - Intergenic
1106837873 13:33655562-33655584 TCCAATAAAAATATATACAAAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107104720 13:36630760-36630782 CTCAGAAGAAATAGGGACAATGG + Intergenic
1107420993 13:40246281-40246303 CCCATTAAAAAAATGGTCAAGGG + Intergenic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108768623 13:53666999-53667021 CTAAATTAAAATATGGAGGAGGG - Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109127594 13:58537072-58537094 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1109237904 13:59847076-59847098 CTCAAAAAAAAGAAAGACAAAGG + Intronic
1109325679 13:60864886-60864908 CCCATTAAAAATGTGGGCAAGGG - Intergenic
1109392975 13:61717457-61717479 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109904670 13:68824015-68824037 TTCAATTAAAATATGAGCAAGGG - Intergenic
1110325846 13:74214793-74214815 CTCAAAAAAAAAATGGTTAAAGG - Intergenic
1110530493 13:76591830-76591852 CTTAATAAAAATATGTAACATGG + Intergenic
1110595097 13:77311652-77311674 CTCAATAAGAAAATGGAGATGGG + Intronic
1110656005 13:78000512-78000534 CTCAATTAAAAGATGCAGAATGG + Intergenic
1110747950 13:79078702-79078724 CTCAATTAAAAAATAGACAAAGG + Intergenic
1110861837 13:80352981-80353003 CTCAATTAAAACATGGAAAAAGG - Intergenic
1110960380 13:81614910-81614932 CTCAAAAAAATTCTTGACAATGG - Intergenic
1111191828 13:84818858-84818880 CTCAATCAAAAAAAGGTCAAAGG - Intergenic
1111215034 13:85130327-85130349 CTCACAAAAAATATGTATAATGG + Intergenic
1111304570 13:86390481-86390503 ATAAATAAAAATAAGGAGAAAGG + Intergenic
1111744714 13:92253059-92253081 CTCAATTAAAATATGAAAATAGG - Intronic
1111788728 13:92825378-92825400 TGCAATAAAAATAAAGACAAGGG + Intronic
1111873124 13:93859640-93859662 CCCAAAAAAGATATGTACAAAGG - Intronic
1111899588 13:94184458-94184480 CCCATTAAAAAAATGGACAAAGG + Intronic
1112049060 13:95627453-95627475 CCCAATTAAAAAATGGGCAAAGG + Intronic
1112161206 13:96869951-96869973 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112836793 13:103524872-103524894 TTAAATAAAAATATGCATAATGG + Intergenic
1113021408 13:105891473-105891495 ATCTAAAAAAATATGGACAAAGG - Intergenic
1113063326 13:106349055-106349077 CTCAATAAAAGAATGGGAAAGGG + Intergenic
1113115539 13:106870774-106870796 AACCATAAAAATATGGACTATGG - Intergenic
1113229556 13:108196790-108196812 CTCAGTATCAATCTGGACAAAGG - Intergenic
1113272397 13:108687665-108687687 CACAATAGAAAAATGAACAAGGG + Intronic
1114158289 14:20132490-20132512 CTCATTAAAAAAGTGGGCAAAGG - Intergenic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114695710 14:24625332-24625354 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1114826456 14:26086540-26086562 CTCAATAAAAATAAGAAAACTGG - Intergenic
1114831289 14:26144949-26144971 CTTATTAAAAATAATGACAATGG - Intergenic
1114939118 14:27584321-27584343 CTCATTAGAGATATGGAAAAGGG - Intergenic
1114990229 14:28277480-28277502 ACCAATAAAAGTATGGACAGAGG + Intergenic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116073715 14:40083499-40083521 CCCCATTAAAATATGGGCAAAGG + Intergenic
1116231724 14:42227084-42227106 CTCACTTAAAAAATGGGCAAAGG - Intergenic
1116264622 14:42671769-42671791 CTCAAAAAATATATTGCCAAAGG + Intergenic
1116491927 14:45514765-45514787 TTCAATTAAAAAATGGACAGAGG + Intergenic
1116521911 14:45859191-45859213 CCCCATTAAAATATGGGCAAAGG - Intergenic
1116723164 14:48527109-48527131 CTCCATTAAAAAATAGACAAAGG - Intergenic
1117090242 14:52243210-52243232 CTCAACACAAATATGTACCAAGG + Intergenic
1117122851 14:52587407-52587429 CAAAGTAAAAATATGTACAAAGG + Intronic
1117131357 14:52690438-52690460 CCCAATTAAAAAATGGGCAAGGG + Intronic
1117257685 14:53996251-53996273 TTCAATAAAAAAATGAGCAAAGG + Intergenic
1117640289 14:57791304-57791326 CCCCATCAAAAAATGGACAAAGG + Intronic
1117905528 14:60581496-60581518 CCAACTAAAAATATGGGCAAAGG - Intergenic
1118102320 14:62620760-62620782 CTCAATGAAAATATGAAATAGGG + Intergenic
1118805467 14:69232721-69232743 CCCAATTAAAACATGGGCAAAGG - Intronic
1118832164 14:69444188-69444210 CTCAAAAAAAATAAAGACAAAGG + Intronic
1119089527 14:71768052-71768074 TCCAATAGAAAAATGGACAAAGG + Intergenic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120123871 14:80717043-80717065 CCCAATTAAAAAATGGATAAAGG - Intronic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1120240847 14:81948115-81948137 CTCAATAGAAATTTGTACACAGG + Intergenic
1120352997 14:83387070-83387092 CCCAATTAAAATATGGGAAAAGG - Intergenic
1120452257 14:84683387-84683409 CCCAATTAAAATGTGGGCAAAGG - Intergenic
1120688957 14:87570966-87570988 GTCTATAATAATATTGACAATGG + Intergenic
1121464803 14:94108841-94108863 CACAACATAAATATGGACCAGGG + Intronic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1123455704 15:20422408-20422430 CTCCATTAAAAAATGGACAAAGG - Intergenic
1124258609 15:28166312-28166334 CACCAAAAAAATATGGAAAAAGG + Intronic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1125380698 15:39083714-39083736 CTCAACAAGAATATGAAGAAGGG - Intergenic
1125841372 15:42804142-42804164 CTCATTAAAAATATTAACAATGG + Intronic
1125963566 15:43853565-43853587 CCCAATTAAAAAATGGGCAAAGG + Intronic
1126192600 15:45894153-45894175 CTTAATAAAAATGTTGAAAAAGG + Intergenic
1126376830 15:48005358-48005380 CTCAACTAAAATATGGATGATGG - Intergenic
1126384434 15:48079329-48079351 CCCAATAAGAAAATAGACAAAGG + Intergenic
1126496555 15:49297252-49297274 CTCCATTAAAAAATGGGCAAAGG - Intronic
1126927337 15:53604644-53604666 CTCTATTAAAACATGGGCAAAGG + Intronic
1126936788 15:53719011-53719033 CTCAATAAAAATTTGTTCCATGG + Intronic
1126968105 15:54078650-54078672 CTCCATTAAAAGGTGGACAAAGG - Intronic
1127048904 15:55059139-55059161 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1127192959 15:56551659-56551681 GGCAATTAAAAAATGGACAAGGG + Intergenic
1127196990 15:56597961-56597983 CTCAATATAAATATTGAAAAAGG + Intergenic
1127309001 15:57735329-57735351 CTGAAGTATAATATGGACAAAGG - Intronic
1127399081 15:58567501-58567523 CATAATCAAAATATGCACAAAGG + Intronic
1127898900 15:63326715-63326737 CACAATAAAAACATGGACAAAGG + Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1128331518 15:66758809-66758831 CTTAACAAAATTATGGAGAAAGG + Intronic
1128436030 15:67649211-67649233 CTCATTTAAAAAATAGACAAAGG - Intronic
1128745098 15:70108275-70108297 CTCAGTCAAAAAATGGGCAAAGG + Intergenic
1128807667 15:70544208-70544230 CTCAATTAAAAATTGGGCAAAGG + Intergenic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129578015 15:76774234-76774256 CTAAATTGAATTATGGACAAAGG + Intronic
1129583462 15:76837207-76837229 CCCAATTAAAAAATGGGCAAAGG + Intronic
1129744977 15:78012073-78012095 CTTGTTAAAAATATGGATAAAGG - Intronic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1130178604 15:81601901-81601923 CTAAATAAGAACATGGAAAATGG + Intergenic
1130238106 15:82157787-82157809 CTGAATTAAAATCTGGACACAGG + Exonic
1130600939 15:85272628-85272650 TCCAGTAAAAATCTGGACAAGGG + Intergenic
1130773641 15:86952508-86952530 CTCATTTAAAAAATGGGCAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1130940621 15:88505579-88505601 CTCAACAAAAATGATGACAATGG + Intergenic
1131026647 15:89148243-89148265 ATCAATAGAAAAATAGACAAAGG + Intronic
1131105566 15:89731759-89731781 CTCAATAAACACATGGGCAGTGG - Intronic
1131424277 15:92332940-92332962 CTCAATAGAAAAATAGTCAAAGG - Intergenic
1131592632 15:93766514-93766536 CTCAATAATAATTTCGGCAAAGG - Intergenic
1132108102 15:99079592-99079614 CCCAATAGAAATATGCAGAAAGG - Intergenic
1132130283 15:99271088-99271110 CTCAATTAAAAAATGGGCAAAGG - Intronic
1132159911 15:99531048-99531070 CCCAATTAAAAAATTGACAAGGG + Intergenic
1133824128 16:9261883-9261905 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1133920066 16:10144484-10144506 GACAATTAAAAAATGGACAAAGG - Intronic
1134070788 16:11258424-11258446 CTCTTTAAAAAAATGGACACAGG - Intronic
1134420359 16:14081872-14081894 TCCAATTAAAAAATGGACAAAGG - Intronic
1135008133 16:18846542-18846564 CCCAATTAAAAAATGGGCAAAGG + Intronic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1135475103 16:22767382-22767404 CCCAATAGAAAAATGGTCAATGG - Intergenic
1135715234 16:24759063-24759085 CTCAAAAAAAAGATGAATAAAGG + Intronic
1136059397 16:27715607-27715629 CCCAATTAAAATATGGCCAAAGG + Intronic
1137255509 16:46771852-46771874 GCCAATCAAAATATGAACAAGGG + Intronic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1137706114 16:50537061-50537083 CTCATTAAAAACCTGGAAAATGG - Intergenic
1138040152 16:53654829-53654851 CTCAATAAAAATTTGTTTAATGG - Intronic
1138291483 16:55851310-55851332 CTCAATTCAAAAATGGGCAAGGG + Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138854388 16:60670942-60670964 CTCCATTAAAATATTGGCAAAGG - Intergenic
1138900970 16:61269592-61269614 CTCAACTAAAAAATGAACAATGG - Intergenic
1138934665 16:61704332-61704354 CTCAATAAACATATGACAAATGG - Intronic
1139704890 16:68734465-68734487 CTCAATAAATATTTGGAGTAGGG - Intergenic
1139712973 16:68790557-68790579 CTCAAAAAGAATAAGGAGAATGG - Intronic
1139766635 16:69236046-69236068 ATCAATATAAATAAGGACACAGG + Intronic
1140008221 16:71101505-71101527 CACAATAGAAAAATGGGCAAAGG + Intronic
1140125567 16:72115353-72115375 CCCATTAAAAAAATGGGCAAAGG - Intronic
1140413607 16:74757172-74757194 ATCAATAGAAAGATGGATAAAGG + Intronic
1140561458 16:75986927-75986949 CCCAATTACAAAATGGACAATGG + Intergenic
1140578871 16:76205100-76205122 CCCAATTAAAAAATAGACAAAGG - Intergenic
1141175375 16:81715069-81715091 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1141445137 16:84052843-84052865 CCCAATTAAAATATGGACAAAGG + Intergenic
1141916944 16:87104627-87104649 CCTAATTAAAATGTGGACAAAGG - Intronic
1142175841 16:88644859-88644881 CACAATAGAAAAATGGGCAAAGG + Intronic
1142656444 17:1397732-1397754 CTCAATAAAGGAATGGACACAGG + Intronic
1142713627 17:1736510-1736532 AGCAAGACAAATATGGACAAGGG - Intronic
1143089890 17:4443797-4443819 CCCAATAGAAAAATGGACAGTGG + Intronic
1143241753 17:5449352-5449374 CCCAGTAGAAAAATGGACAAAGG + Intronic
1143428236 17:6857668-6857690 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1143823271 17:9582476-9582498 CTCAATAGAAAAATGAGCAAAGG - Intronic
1144570416 17:16394548-16394570 CACAATAGGAAAATGGACAAAGG + Intergenic
1144821849 17:18080627-18080649 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1145848525 17:28066921-28066943 CCCAATTAAAATATGGGCAAAGG - Intronic
1146147318 17:30431288-30431310 CTCAATTAAAAATTGGACAAAGG - Intronic
1146246623 17:31290046-31290068 CTCAATGAATAAATGGGCAAAGG - Intronic
1146788509 17:35738203-35738225 CCCAATAGAAAAATGGGCAAAGG - Intronic
1146866691 17:36342267-36342289 CTCAATTCAAAAATGGGCAAAGG - Intronic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1147069559 17:37942876-37942898 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147081089 17:38022414-38022436 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147097031 17:38146371-38146393 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1148379021 17:47178801-47178823 CTCAAAAAAAAAACGGAAAAAGG - Intronic
1149138033 17:53393974-53393996 ATCAATAAAAATAAAAACAAAGG - Intergenic
1149502956 17:57168980-57169002 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1149889850 17:60378115-60378137 CTCAATTCAAAAATGGGCAAAGG + Intronic
1149951326 17:60990277-60990299 ATCTGTAAAAATAAGGACAAAGG - Intronic
1149999178 17:61422129-61422151 CTCAATTACAAAATGGGCAAAGG + Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150112630 17:62515651-62515673 CCCAATGAAAAAATGGGCAAAGG - Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150232373 17:63563175-63563197 TGCAATAGAAAAATGGACAAAGG + Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1150744534 17:67805745-67805767 CTCCAGAAAAATATGCAAAATGG - Intergenic
1150792740 17:68212025-68212047 CTCCAGAAAAATATGCAAAATGG + Intergenic
1150894089 17:69189351-69189373 CCCCATTAAAAAATGGACAAAGG - Intronic
1151024650 17:70663567-70663589 CTCCACTAAAATATGGAAAAAGG - Intergenic
1151205557 17:72504021-72504043 CTCAATAAATATTTGAACAAAGG - Intergenic
1152493360 17:80653055-80653077 CCCAACTAAAAAATGGACAAAGG - Intronic
1153236149 18:2990451-2990473 TTCAATTAAAATATGGGCAAAGG + Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153399886 18:4672229-4672251 CTTCATTAAAATGTGGACAAAGG + Intergenic
1153548106 18:6230905-6230927 CCCATTAAAAAAGTGGACAAAGG - Intronic
1153605190 18:6826299-6826321 CTCCATTAAAAAATGGGCAAAGG - Intronic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153785831 18:8534401-8534423 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1154130447 18:11732492-11732514 CCCAATTAAAATAGGAACAAAGG - Intronic
1154180412 18:12133697-12133719 ATCAATTAAAACATGGTCAAAGG - Intergenic
1154227461 18:12519643-12519665 CTCATTAGAAAAATGAACAAAGG + Intronic
1154282757 18:13020896-13020918 CTCAATTAAAAAGTGGGCAAAGG - Intronic
1154372932 18:13781135-13781157 CTCAAAAAAAAAGTGGGCAAAGG + Intergenic
1155029365 18:21970999-21971021 CTCAATACAACTATTTACAAAGG + Intergenic
1155260305 18:24035599-24035621 CCCAATTAAAAAATGGGCAAAGG - Intronic
1155376671 18:25165777-25165799 CTCATTAACCATATGGAAAATGG - Intronic
1155693416 18:28654224-28654246 CTCCATCAAAAAATGGGCAAAGG + Intergenic
1155794546 18:30019427-30019449 CTCAAACAAAATATTAACAAAGG - Intergenic
1155859418 18:30878183-30878205 CTGAATTAAGATAAGGACAAAGG + Intergenic
1156135171 18:34028986-34029008 CTCAATAGAAGGATGGAAAAAGG - Intronic
1156230393 18:35148565-35148587 CTCAATAAAATAATGGCAAATGG - Intergenic
1156256766 18:35405624-35405646 ACCAATTAAAATATGGGCAAAGG + Intergenic
1156419781 18:36938424-36938446 CTCAATCAAAATATGGGCAAAGG - Intronic
1156509299 18:37622392-37622414 ATCTATAAAAATATTCACAAAGG + Intergenic
1157008338 18:43614487-43614509 GTAAATAAAAATGTGGAAAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1157376333 18:47169773-47169795 CTCAATTAAAACATTTACAAAGG - Intronic
1157759186 18:50247092-50247114 CCCAACTAAAATATGGGCAAAGG + Intronic
1157882519 18:51334294-51334316 CCCAATTAAAATATGGGCAAAGG - Intergenic
1157917724 18:51684305-51684327 TTCAATTAAAAAGTGGACAAAGG + Intergenic
1158132377 18:54166960-54166982 CTCAATAAAGATATGTTGAATGG - Intronic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158298289 18:56023657-56023679 TCCAATTAAAAAATGGACAAAGG - Intergenic
1158738043 18:60106290-60106312 CCCCATTAAAAAATGGACAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159573112 18:70143181-70143203 CTCCATTAAAAAGTGGACAAAGG - Intronic
1159598245 18:70404113-70404135 CGCAAAAAAAATATGAACACAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160097090 18:75884196-75884218 CTCACTAAGAACATTGACAAAGG - Intergenic
1160197511 18:76768421-76768443 CTCAACTAAAAAATGGGCAAAGG - Intergenic
1160929633 19:1564230-1564252 CTCAATAAAGATCTAGCCAATGG + Intronic
1160993311 19:1870280-1870302 CTGAATAATAATAATGACAATGG + Intergenic
1162233492 19:9286133-9286155 CACAATAAAAATATTAATAAAGG - Intergenic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1163060232 19:14755450-14755472 CTCAATAAAAAAAAGAACACAGG + Intronic
1163293669 19:16398025-16398047 GTCCACAAAAATAGGGACAATGG + Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1164190048 19:22906153-22906175 CAGAATAAAAATGTGGAAAATGG - Intergenic
1164440700 19:28276618-28276640 ATCAATTAAAATATGCTCAAAGG - Intergenic
1164765938 19:30769745-30769767 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1164954515 19:32370554-32370576 CTCGATTAAAAAATGGGCAAAGG - Intronic
1165083104 19:33322448-33322470 CCCAATTAAAAAGTGGACAAAGG + Intergenic
1165133729 19:33650350-33650372 CTCAATTAATTTATGGGCAAAGG - Intronic
1165133732 19:33650395-33650417 CTCAATTAATTTATGGGCAAAGG - Intronic
1165251211 19:34537218-34537240 CTAAAGAAATATATGAACAAAGG - Intergenic
1165338826 19:35195530-35195552 CTCAATAACAAAATGGAGATGGG - Intergenic
1166023254 19:40053233-40053255 CCCAATTAAAAAATGGGCAAAGG + Intronic
1166095891 19:40538896-40538918 CTTAATAAATATTTGAACAAGGG + Intronic
1166272459 19:41723485-41723507 CCCAATTAATAAATGGACAAAGG - Intronic
1166419313 19:42623849-42623871 CCCGATTAAAAAATGGACAAAGG + Intronic
1166430938 19:42727427-42727449 CCCAATTAAAAAATGAACAAAGG + Intronic
1166443951 19:42842763-42842785 CCCAATTAAAAAATGAACAAAGG + Intronic
1166456699 19:42947534-42947556 CCCAATTAAAAAATGGACAAAGG + Intronic
1166463633 19:43013427-43013449 CCCAATTAAAAAATGAACAAAGG + Intronic
1166466656 19:43038400-43038422 CCCAATTAAAAAATGGACAAAGG + Intronic
1166480916 19:43173521-43173543 CCCAATTAAAAAATGAACAAAGG + Intronic
1166490490 19:43256507-43256529 CCCAATTAAAAAATGAACAAAGG + Intronic
1166493563 19:43281457-43281479 CCCAATTAAAAAATGGACAAAGG + Intergenic
1167580642 19:50339834-50339856 CTCATTAGGAAAATGGACAAAGG + Intronic
1167704764 19:51074689-51074711 CCCAATTAAAAAATGGACAAAGG + Intergenic
1167726191 19:51214651-51214673 TCCAATGAAAAAATGGACAAAGG - Intergenic
1168479727 19:56709561-56709583 CCCAATGAAAAAATGGACAAAGG - Intergenic
924972147 2:138187-138209 CGAATTAAAAAAATGGACAAGGG - Intergenic
925655879 2:6148546-6148568 CTCAATAAATCTATCGAAAATGG + Intergenic
925788845 2:7461674-7461696 CTCCATTAAAAAGTGGACAAAGG + Intergenic
926122142 2:10248195-10248217 CTCAATCAAAACATGGGCAAAGG - Intergenic
927070267 2:19521500-19521522 CCCCATTAAAAAATGGACAAAGG + Intergenic
927473964 2:23397778-23397800 CTCCATTAAAAAATGGGCAAAGG + Intronic
927609899 2:24527989-24528011 CTCAATTAAAAAATGGGCAAAGG - Intronic
927610294 2:24532278-24532300 CTCCATCAAAAAATGGGCAAAGG - Intronic
928475277 2:31619761-31619783 CCCCATAAAAAAGTGGACAAAGG - Intergenic
928621883 2:33098265-33098287 CCCAATAGGAAAATGGACAAAGG - Intronic
928825350 2:35413883-35413905 CTCCATCAAAATGTGGGCAAAGG - Intergenic
928881011 2:36096494-36096516 CTCAATAAAAATTTGCTAAATGG + Intergenic
929496843 2:42452066-42452088 CCCAACTAAAAAATGGACAAAGG + Intronic
929821705 2:45279382-45279404 CCCAAAAGAAAAATGGACAAAGG - Intergenic
930083836 2:47478095-47478117 TTCAATAGAAAAATGGGCAAGGG - Intronic
930328958 2:49958185-49958207 CTCATTAAATACATGCACAAAGG - Intronic
930552906 2:52858249-52858271 ATAAGTATAAATATGGACAAAGG + Intergenic
930589430 2:53309722-53309744 CCCAATTAAAAAATGGACAAAGG + Intergenic
930837595 2:55811153-55811175 CTGAAGAAAAATAAGGAAAATGG - Intergenic
930985210 2:57577574-57577596 AGCAAAACAAATATGGACAATGG - Intergenic
931105427 2:59049825-59049847 CTCAATAAACCTAAGGAAAAAGG - Intergenic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932899037 2:75676941-75676963 TTCAATAAAAATATTGAACAGGG + Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933251210 2:80030803-80030825 ATCAATAAAAATCTGAAAAATGG + Intronic
933393051 2:81696802-81696824 CCCCATAAAAATGTGGGCAAAGG + Intergenic
933426894 2:82125465-82125487 ACCAATATAAATATGTACAAAGG + Intergenic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
933807103 2:86007261-86007283 CCCAATTAAAAAATGGGCAAAGG + Intergenic
933808935 2:86020144-86020166 CCCAATAGAAAAATGGGCAAAGG + Intergenic
934103581 2:88676228-88676250 CTCAATAAAGTTTTGGTCAAAGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
934522474 2:95027895-95027917 CCCAATTAGAAAATGGACAATGG + Intronic
934664498 2:96160207-96160229 CCCATTTAAAAAATGGACAAAGG + Intergenic
935012280 2:99146308-99146330 CCCAATAGAAAAATGGGCAAAGG - Intronic
935421164 2:102870645-102870667 CTCAATAAAAAAATTGAAATTGG + Intergenic
935536942 2:104305886-104305908 CTAACTAAAAATATGTACACTGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936878805 2:117224736-117224758 TTCCATCAAAATGTGGACAAGGG - Intergenic
936988680 2:118338599-118338621 CTCAAGAAAAAAATAGAAAAAGG - Intergenic
937614012 2:123898107-123898129 TTCAATTAAAAAATGGGCAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937932242 2:127215878-127215900 CCCAATTAAAAACTGGACAAAGG + Intronic
938851003 2:135259400-135259422 ATAAATAAAAATATGTAGAATGG - Intronic
938869356 2:135457746-135457768 CTCAATTAAAAAATGGGCAAAGG - Intronic
939093793 2:137809191-137809213 CTCCATTAAAAAATGGGCAAAGG - Intergenic
939301475 2:140346424-140346446 CTCAATAATAATATTGACTCAGG - Intronic
939414265 2:141873152-141873174 CTTAATTAAAATAATGACAAAGG + Intronic
939747831 2:145999495-145999517 CTCCATTAAAAAGTGGACAAAGG + Intergenic
940194270 2:151076106-151076128 CTCAATTAAAAAATGGGCAAAGG + Intergenic
940981516 2:160008867-160008889 CCCAATTAAAAAATGGACAAAGG + Intronic
941118290 2:161497555-161497577 CTCAATTACAAAATGGGCAAAGG - Intronic
941178742 2:162233541-162233563 CTCCATTAAAAAATGGACAAAGG - Intronic
941228503 2:162879239-162879261 CCCCATCAAAAAATGGACAAAGG + Intergenic
941743171 2:169058121-169058143 CTCCATTAAAAAGTGGACAAAGG + Intergenic
941885002 2:170518954-170518976 CTCAATCAAAATGTGGAAATAGG + Intronic
942190898 2:173469307-173469329 CTCAATTAAAAAATGGGTAAAGG - Intergenic
942242862 2:173979561-173979583 CTCAATAGAAAATTGGATAAAGG - Intergenic
942643023 2:178079969-178079991 CCCCATTAAAAAATGGACAAAGG - Intronic
942657287 2:178227121-178227143 CCCACTAGAAAAATGGACAAAGG + Intronic
942806207 2:179933994-179934016 TTCAATAAAAATGTGCACACAGG - Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
942918343 2:181340122-181340144 CTCAATAAATATCTAGACATGGG + Intergenic
943006070 2:182389420-182389442 CCCAATTAAAAAATGGACAAAGG + Intronic
943016708 2:182519826-182519848 TTAAATAAAAATAGAGACAAAGG - Intronic
943087767 2:183333764-183333786 CTCAATTAAAAGATGGGCAAAGG - Intergenic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
943532759 2:189105526-189105548 CCTAATAAAAATATAGGCAAGGG - Intronic
943653949 2:190487570-190487592 CCCAATTAAAAAATGGGCAAAGG + Intronic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
943788393 2:191903803-191903825 CTCAACAAAATAATGGGCAAAGG - Intergenic
943805192 2:192115665-192115687 CTCAATCAAAATATGGGCAAAGG + Intronic
943956864 2:194202813-194202835 ATCCATTAAAAAATGGACAATGG - Intergenic
943970513 2:194399256-194399278 TTCAATTAAAATATGGGCAAAGG - Intergenic
944122451 2:196254903-196254925 CCCAATAGAAAAATGGATAAAGG - Intronic
944727157 2:202483179-202483201 CCCAATTAAAAAATGGGCAAAGG - Intronic
944748773 2:202686088-202686110 ATCAGTTAAAAAATGGACAATGG + Intronic
944755122 2:202753679-202753701 CCCCATCAAAAAATGGACAAAGG + Intronic
944888657 2:204092646-204092668 TTCAATTAAAAAATGGGCAATGG - Intergenic
945016667 2:205525761-205525783 CTCAATGAGAATCTCGACAAAGG + Intronic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
945500734 2:210570522-210570544 CAAAATAAAAATATAAACAAAGG + Intronic
945664402 2:212722719-212722741 TTCTATGAAAATATAGACAAGGG + Intergenic
945795173 2:214353974-214353996 CTCAATAAAGATATACACAAAGG + Intronic
945819342 2:214644606-214644628 CTCAATTGAAAAATGGGCAAAGG - Intergenic
945985865 2:216352945-216352967 CTCAATAAATATTTGCAGAATGG + Intronic
946272044 2:218602536-218602558 AAAAATAAAAATATGGCCAAGGG - Intergenic
946396669 2:219446913-219446935 CTTAATAAAAATCTGTAAAATGG - Intronic
946490127 2:220140669-220140691 CTCAGTTAAAAAATGGGCAAAGG - Intergenic
946574497 2:221059529-221059551 CTCAATTAAAAACTGGGCAAAGG - Intergenic
946765436 2:223036099-223036121 CACAATACAAATGTGGGCAAGGG - Intergenic
946856246 2:223952605-223952627 CAAAATTAAAATATGTACAACGG - Intergenic
946947838 2:224840429-224840451 CCCAATGAAAAAATGGGCAAGGG + Intronic
947044372 2:225963575-225963597 TCCCATTAAAATATGGACAAAGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947301826 2:228696516-228696538 CTCCATCAAAAAGTGGACAAAGG + Intergenic
947320045 2:228907222-228907244 CCCAATGAAAAAATGCACAAAGG + Intronic
947449178 2:230190378-230190400 CTCCATCAAAAAATGGGCAAAGG - Intronic
947607541 2:231498209-231498231 CCCAATTAAAAAATGGGCAAAGG - Intergenic
947702732 2:232248392-232248414 ATCAAGAAAAATATGGGAAAAGG + Intronic
948358573 2:237400721-237400743 CTCAAAAAAATTAAAGACAAAGG + Intronic
1168945280 20:1749379-1749401 CTCCATGAAAATGTGGGCAAAGG + Intergenic
1169732266 20:8799151-8799173 AGAAAGAAAAATATGGACAAAGG - Intronic
1169972438 20:11282876-11282898 CCCAATTAAAAGATGGAAAAAGG + Intergenic
1170051879 20:12155192-12155214 CTCAATGAACATATTCACAATGG - Intergenic
1170504219 20:17008200-17008222 CCCAATTAAAAAATGGTCAAAGG - Intergenic
1170712050 20:18800141-18800163 CACAATAAAAAAATATACAAAGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172423651 20:34838938-34838960 CTCAATTAAAATATGGGCAAAGG - Intergenic
1173129431 20:40375504-40375526 ATCAATAGAAAAATGGGCAAAGG - Intergenic
1173238688 20:41273201-41273223 CCCAATTAAAATATGGGCAAGGG - Intronic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173778685 20:45735587-45735609 CCCATTTAAAAAATGGACAAGGG + Intergenic
1173939962 20:46902228-46902250 TTCACTAAAAATAAGCACAAAGG - Intronic
1174618795 20:51857945-51857967 CTCAGTCAAAATATGGGCAAAGG + Intergenic
1174850240 20:53986887-53986909 CTCAAAAAAAATATAGAATATGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176685282 21:9842816-9842838 CTGAAGAAAAATAAGGATAAGGG + Intergenic
1176931083 21:14811006-14811028 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1177037254 21:16059919-16059941 CTCAAGCAAAATTTGGGCAAAGG - Intergenic
1177105646 21:16952211-16952233 TCCAATTAAAATATGGGCAAAGG + Intergenic
1177300219 21:19234454-19234476 CACAATTAAAAAATGGGCAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177604921 21:23365523-23365545 ATCAATCAAATTATGGACACAGG - Intergenic
1178004339 21:28199672-28199694 CCCCATTAAAAAATGGACAAAGG + Intergenic
1178197348 21:30362295-30362317 GTCAACAAAAATATACACAAGGG + Intronic
1178227479 21:30739766-30739788 CTCAATGGAAAAATGGGCAAAGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179085165 21:38209899-38209921 CAAAATTTAAATATGGACAATGG + Intronic
1179094675 21:38302194-38302216 TTCTATAAAAATATGAACATTGG + Exonic
1179158936 21:38876027-38876049 CCTTATAAAAATATGGAGAATGG - Intergenic
1179519954 21:41936268-41936290 CCCAATTAAAAAATGGGCAAAGG + Intronic
1179636148 21:42710985-42711007 CTCAAAAAAAATATGTAAAAAGG + Intronic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180323846 22:11349777-11349799 CTCCATTAAAACATTGACAAGGG + Intergenic
1180566222 22:16667832-16667854 ATCAATTAAAACATGGTCAAAGG + Intergenic
1181322069 22:22015534-22015556 CCCAATTATAATATGGGCAAAGG + Intergenic
1181329946 22:22082499-22082521 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182140982 22:27958119-27958141 CCCAAATAAAATATGGGCAAAGG + Intergenic
1182148041 22:28009428-28009450 CTCACTGAAAATGTGGAGAAGGG + Intronic
1182336887 22:29589626-29589648 CTCAAAAAAAAAATGAACAAAGG + Intergenic
1182927889 22:34143755-34143777 CTCTATTAAAAGATGGGCAAAGG - Intergenic
1182937375 22:34238034-34238056 CCCCATTAAAAAATGGACAAAGG + Intergenic
1183001140 22:34860184-34860206 CTCAATAAAGATTTGTATAAAGG + Intergenic
1184318727 22:43722062-43722084 CCCCATTAAAAAATGGACAAAGG + Intronic
1184704937 22:46204683-46204705 CTCAATTAAAAAATGAGCAAAGG - Intronic
1184944192 22:47789886-47789908 CCCAATAAGAATAAGGACCATGG + Intergenic
1185064808 22:48626507-48626529 CCCAATTAAAACATGGGCAAAGG - Intronic
1185303029 22:50093231-50093253 CTCAACAAAAATGTGGACAAAGG - Intronic
1185363836 22:50425848-50425870 CTCAATTCAAAAATGGTCAAAGG - Intronic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949144088 3:674007-674029 CCCAATTAAAACATGGGCAAAGG + Intergenic
949159639 3:865068-865090 CCCTATTAAAATATGGGCAAAGG - Intergenic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
949840524 3:8315204-8315226 TTCAATAAATATTTGGAGAATGG - Intergenic
949898261 3:8787007-8787029 CCCAATTAAAAAATGGGCAAAGG - Intronic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
951069903 3:18315380-18315402 ATCAATCAAAAAATGGACAAAGG - Intronic
951267835 3:20590217-20590239 CCCATTGAAAAAATGGACAAAGG - Intergenic
951649594 3:24936153-24936175 CTCTATACAAACATGGACCATGG - Intergenic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
952039140 3:29240845-29240867 CTCCTTAAAAATAAAGACAATGG + Intergenic
952310450 3:32184368-32184390 CTCAATTAAAAAACTGACAAAGG + Intergenic
952402024 3:32972037-32972059 ATCAAAAAGAATATGGACATAGG + Intergenic
952513735 3:34082558-34082580 CTCAATAAAAAAAATGATAAAGG - Intergenic
952679999 3:36080655-36080677 CTCCATCAAAAAGTGGACAAAGG - Intergenic
953029795 3:39171435-39171457 CTCAATAAAAAGAAAGAAAATGG + Intergenic
953037133 3:39222501-39222523 CCCAATTAAAAAATGGGCAAAGG + Intergenic
953164126 3:40449206-40449228 CTCTCAGAAAATATGGACAAAGG + Intergenic
953276023 3:41499172-41499194 CTCAATAAAAATATTGGCAAGGG - Intronic
953502654 3:43453005-43453027 CCCAATTAAAAAATGGGCAAAGG - Intronic
953560298 3:43984695-43984717 CTCCATCAAAAAATGGGCAAAGG - Intergenic
954376881 3:50199409-50199431 CTCAATTCAAAAATGGGCAAAGG - Intergenic
955213004 3:56959541-56959563 ATCCATAAAAATATTGAAAAAGG - Intronic
955268735 3:57474972-57474994 CTCAAAAAAAAAAAGGCCAATGG + Intronic
956803039 3:72780293-72780315 CTGAATAAAACTATTGGCAAAGG - Intronic
956904251 3:73749588-73749610 CTCAATAAATATTTGTAGAATGG - Intergenic
956997323 3:74842581-74842603 CTGTATAAAAATATGTATAATGG - Intergenic
957655888 3:83074860-83074882 CCCAATTAAAAAATGGGCAAAGG + Intergenic
958504923 3:94963891-94963913 TTGAATAACAATTTGGACAATGG + Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958512559 3:95066865-95066887 ATCAAAAAAAAAATGGGCAAAGG + Intergenic
958738812 3:98043119-98043141 CCCAATAAAAAAATGGGCCAAGG + Intergenic
959048657 3:101502746-101502768 CTCTATAAAAATATTTAAAAAGG + Intronic
959290375 3:104466232-104466254 CTCAATAAAATACTGGAAAACGG - Intergenic
959307810 3:104691774-104691796 CTCCATCAAAAAGTGGACAAAGG - Intergenic
959613720 3:108323443-108323465 CTCAATAAAAATTTAGGGAAGGG - Intronic
959662754 3:108887669-108887691 CTCTAGAAAAATAAAGACAAAGG + Intergenic
959777016 3:110178290-110178312 CGTACTAAAAATATTGACAAAGG - Intergenic
959805823 3:110552530-110552552 CTAAATAAAAATCTTGATAAGGG - Intergenic
959825181 3:110785725-110785747 CTCTATAAAAAAGTGGGCAAAGG - Intergenic
959867193 3:111284179-111284201 CTCCCTAAAAATATGGGCAGAGG + Intergenic
959881871 3:111453000-111453022 CTCATTAAAAAAATGAGCAAAGG + Intronic
959957935 3:112260344-112260366 CTAAAGAAAAAAATGGACATAGG - Intronic
959969519 3:112393591-112393613 GTCTAAAAAAATATGGAGAAAGG - Intergenic
960118423 3:113921782-113921804 CCCAATAAAAAAGTGGGCAAGGG - Intronic
960312509 3:116133610-116133632 CTCAATTTAAATATGGAAAGAGG - Intronic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960551659 3:118982541-118982563 GACAATAAAAAGAAGGACAAAGG + Intronic
960633837 3:119763136-119763158 CCCAATTAAAAAATGGGCAAAGG + Intronic
960772509 3:121210256-121210278 CTCCATCAAAAAATGGGCAAAGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961233460 3:125341692-125341714 CTCAATAAAAACATAGAGATGGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
962634534 3:137317086-137317108 CTCAATAAAAAAATGATAAAGGG - Intergenic
962819180 3:139030880-139030902 CCCAACTAAAAAATGGACAAAGG - Intronic
963144889 3:141983333-141983355 CTCAATTCAAAAATGGGCAAAGG + Intronic
963333349 3:143941808-143941830 TCCAATTAAAAAATGGACAAAGG + Intergenic
963401036 3:144800056-144800078 CCCAATAAAAAAATGGCCAAAGG - Intergenic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
963868666 3:150389834-150389856 GACAATAAAAGTATGTACAAAGG - Intergenic
963913394 3:150834943-150834965 CTCCATTAAAAAATGGGCAAAGG - Intergenic
964021256 3:152014328-152014350 CACAATAAAAATCAGGACAATGG - Intergenic
964088007 3:152841417-152841439 CTCAATAAAACTATGAAACATGG + Intergenic
964130729 3:153283332-153283354 TTCCATAAAAATATGGGGAAGGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964678287 3:159308345-159308367 CCCCATCAAAATATGGATAAAGG + Intronic
964922973 3:161920244-161920266 CCCCATTAAAATATGAACAAAGG + Intergenic
964942524 3:162176887-162176909 CTCAATGAAAGTATGGACAGAGG - Intergenic
965049763 3:163630700-163630722 CTCCATTACAAAATGGACAATGG - Intergenic
965103066 3:164327835-164327857 CTCCATCAAAAAGTGGACAAAGG + Intergenic
965128969 3:164670029-164670051 CCCCATCAAAATATGGGCAAAGG + Intergenic
965268579 3:166582526-166582548 CTCCATCAAAAAATGGACAAAGG - Intergenic
965287087 3:166829826-166829848 ATCAATAAAAATAAAAACAAAGG - Intergenic
965998442 3:174916038-174916060 CCCATGAAAAATATGGGCAAAGG + Intronic
966516105 3:180822230-180822252 CCCATTAAAAAAATGGACAAAGG + Intronic
966517954 3:180840126-180840148 CCCAATTAAAACATGGGCAAAGG - Intronic
966655363 3:182350810-182350832 TCCAATAAAAACATGGGCAAAGG + Intergenic
966903187 3:184502118-184502140 CTCAGGAGAAAAATGGACAAAGG + Intronic
967167381 3:186794020-186794042 CCCAATTAAAAAATGGGCAAAGG - Intronic
967172981 3:186838184-186838206 TTCAATTAGAAAATGGACAAAGG - Intergenic
967285096 3:187861469-187861491 CTCCATCAAAAAATGGGCAAAGG + Intergenic
968195687 3:196704269-196704291 CCCAATAAAAAAATGAACAAAGG + Intronic
968801390 4:2745491-2745513 CTCAATAACACTCTGGACAGAGG + Exonic
968860164 4:3161744-3161766 CCCCATCAAAAAATGGACAAAGG - Intronic
970564033 4:17313940-17313962 CTCAGTTAAAAAATGGGCAAAGG - Intergenic
970648754 4:18154482-18154504 CTCAATTAAGAAATGGGCAAAGG + Intergenic
970703900 4:18776472-18776494 CCCATTAAAAAAATGGGCAAAGG + Intergenic
970880110 4:20918809-20918831 CTCAATCCAAATATCCACAAGGG + Intronic
970998493 4:22295337-22295359 CCCCATCAAAATGTGGACAAAGG + Intergenic
971212745 4:24635472-24635494 CCCAGTAGAAATATGGACAAAGG + Intergenic
971237204 4:24853625-24853647 ATCACTAAAAATCTGGAAAAAGG + Intronic
971590750 4:28466407-28466429 CCCCATTAAAATATGGGCAAAGG + Intergenic
971680653 4:29695393-29695415 GTAAATAAAAACATGGACATTGG + Intergenic
971876222 4:32312107-32312129 ATAAATAAAAATATGCACAGTGG - Intergenic
972030711 4:34454171-34454193 CTCCATTAAAAAGTGGACAAAGG + Intergenic
972332096 4:38073549-38073571 CTCAATTAAAAAATGGGCAAAGG - Intronic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
972868660 4:43268246-43268268 CCCCATAAAAATGTGGAAAACGG - Intergenic
972906033 4:43748311-43748333 CTCAAGAAAAATCTAGAAAATGG + Intergenic
972994384 4:44862117-44862139 GTAAATAAAAATATGGAATATGG - Intergenic
973160796 4:47013659-47013681 GTCAATAAAAGAATGAACAATGG - Intronic
973184137 4:47304455-47304477 CCCAATTAAAAGATGGGCAAAGG - Intronic
973721510 4:53728853-53728875 CTCCATCAAAAAGTGGACAAAGG + Intronic
973775384 4:54236967-54236989 CTCAAAAAAAAAGTGGGCAATGG - Intronic
973922245 4:55699747-55699769 CCCAATTAAAAAATGGGCAAAGG + Intergenic
974067435 4:57092219-57092241 CTCAATTCAATTATGTACAAAGG + Intronic
974711328 4:65599965-65599987 GTCAATCAAAATAATGACAAAGG + Intronic
974785436 4:66613864-66613886 CCCAATTAAAAAATGGGCAAAGG - Intergenic
974937495 4:68425492-68425514 CTCCATCAAAAAATGGGCAAAGG + Intergenic
974938687 4:68438200-68438222 CTCCATCAAAAAATGGGCAAAGG + Intergenic
975478398 4:74849458-74849480 CTCCATTAAAAAGTGGACAAAGG - Intergenic
975538575 4:75478342-75478364 CTCAATTAAAACATGGGCAAAGG + Intergenic
975543765 4:75540745-75540767 TTCAATAAAAATAAGGATACTGG + Intronic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
975781672 4:77846962-77846984 AACTATAAAAATATGGAAAAAGG - Intergenic
975895770 4:79088493-79088515 TTCAAGAAAAATAAGAACAATGG - Intergenic
975999961 4:80362391-80362413 AACAATAAAAATAGAGACAATGG - Intronic
976443122 4:85099420-85099442 TTCAATTAGAAAATGGACAAAGG - Intergenic
976849864 4:89532531-89532553 TTCAATAAAATTATAGACACAGG + Intergenic
976868694 4:89763856-89763878 TTGAATAAGAATATGTACAAGGG - Intronic
976933423 4:90598633-90598655 TCCAATTAAAAAATGGACAAAGG - Intronic
977798425 4:101196235-101196257 CTGAATTAAAATATGATCAAGGG + Intronic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
977972890 4:103231639-103231661 CTCCATAAAAAAGTGGGCAAAGG + Intergenic
978030471 4:103936152-103936174 CTCACTAAAAAAATGGGCAAAGG + Intergenic
978925723 4:114240766-114240788 CTCTATAAAAAAGTGGGCAAAGG - Intergenic
978970498 4:114798385-114798407 CTCAATCAAAAAATTGGCAAAGG - Intergenic
979100550 4:116606792-116606814 CGCAATAATAATATGGTCATTGG + Intergenic
979101911 4:116627891-116627913 CTCCATGAAAAAATGGGCAAAGG - Intergenic
979156262 4:117393921-117393943 CTCAAAAAAAATATTGCCTAAGG - Intergenic
979179970 4:117712994-117713016 CCCCATTAAAATGTGGACAAAGG + Intergenic
979362259 4:119778525-119778547 CCCCATAAAAATGTGGACAAAGG - Intergenic
979435787 4:120688304-120688326 CCCAATTGAAAAATGGACAAAGG - Intronic
979581033 4:122361046-122361068 CTCATGAAAAATTTGGAAAATGG + Intronic
979590552 4:122474679-122474701 CCCAATTAAAAAATGGGCAAAGG - Intergenic
980432715 4:132725611-132725633 ATCAATAAAATTATTGAAAAAGG - Intergenic
980653588 4:135752888-135752910 TTCAATAAAAATAAAGAGAATGG + Intergenic
980664093 4:135905728-135905750 CTCCATTAAAATGTGGGCAAAGG - Intergenic
980759783 4:137215950-137215972 CCCAATTAAAAAATGGGCAAAGG - Intergenic
981031748 4:140132261-140132283 CTCAGTAAAAAACTGGAAAAAGG + Intronic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981135784 4:141209618-141209640 CCCAATCAAAAAATGGGCAAAGG - Intronic
981202988 4:142004680-142004702 CCCTATAAAAAAATGGGCAAAGG - Intergenic
981243262 4:142504201-142504223 CTCAATAGAAATAGGGGCAAAGG + Intronic
981305537 4:143243318-143243340 CCCAATAGAAAAATGGGCAAGGG - Intergenic
981349016 4:143707506-143707528 TTCAATGAAAAAATGGGCAAAGG - Intergenic
981410946 4:144430438-144430460 CAAACTAAAAATATTGACAAAGG - Intergenic
981435604 4:144717964-144717986 CTCAATAAATATTTGTAGAATGG - Intronic
981466567 4:145079195-145079217 CTCTATTAAAAAATGGGCAAAGG + Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
981760206 4:148186287-148186309 CTCATTAAAAAAATGGGTAAAGG - Intronic
982059915 4:151594575-151594597 CTCAAAAAAAAAAAAGACAAAGG - Intronic
982190656 4:152851881-152851903 CTCTATTAAAATATGCAAAATGG + Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982583697 4:157210363-157210385 ATCCAGAAATATATGGACAATGG + Intronic
982643009 4:157986188-157986210 TTAAATTAAAATATGGAGAAGGG + Intergenic
982681024 4:158430829-158430851 CTCAAATAAAAAATGGGCAAAGG + Intronic
983371633 4:166866600-166866622 CTCAATCAAAAAGTGGGCAAAGG + Intronic
983436563 4:167722925-167722947 CTCAATTGCAATAAGGACAAAGG + Intergenic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
983886213 4:172983392-172983414 CTCATTCAAAATATGAATAATGG + Intronic
984048514 4:174833979-174834001 CCCAAACAAAAAATGGACAAGGG - Intronic
984062534 4:175008512-175008534 CCCAATTAAAAAATGCACAAAGG - Intergenic
984539030 4:181014056-181014078 CTCAATAAGTATATGAAAAAAGG + Intergenic
985085710 4:186310316-186310338 CCCATTAAAAAAATGGGCAAAGG - Intergenic
985215337 4:187647104-187647126 CCCAATAAAAATATAGGCAAAGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
985799084 5:1991744-1991766 CCCAATAAAAAGACGGGCAAGGG + Intergenic
986589219 5:9351586-9351608 CTCAATAAAATAATGAAAAATGG - Intronic
986621278 5:9678100-9678122 CCCATTAAAAAAATGGGCAAAGG + Intronic
986686641 5:10280679-10280701 CTCACTAAAGATTTGGAGAATGG - Intronic
986907082 5:12508081-12508103 CTCCATTAAAAAATGGGCAAAGG - Intergenic
987682288 5:21153066-21153088 CTTGATACAAATATGGAAAATGG + Intergenic
987711666 5:21508527-21508549 TTCAATGAAAATATGACCAAAGG - Intergenic
987779874 5:22419971-22419993 CCCCATTAAAATATGGGCAAAGG - Intronic
987866896 5:23553475-23553497 TTCATTAAAAAAATGGGCAAAGG - Intergenic
987927170 5:24357106-24357128 CTCAATGAAAAAATTGACAAAGG - Intergenic
987944145 5:24582698-24582720 GTCAATAGAAAGATTGACAAAGG + Intronic
987956031 5:24741335-24741357 CCCAATTAAAACATGGATAAAGG - Intergenic
987988283 5:25178295-25178317 CACAATAAAAAGATGATCAAGGG - Intergenic
988076062 5:26356855-26356877 CTTAATAAAAATAGTGAAAAGGG - Intergenic
988179513 5:27772008-27772030 ATCAATAAAAATGTGGAAAATGG + Intergenic
988302747 5:29452294-29452316 TTCAATGAAAATATGACCAAAGG + Intergenic
988379774 5:30485200-30485222 CTCCATCAAAAAATGGGCAAAGG - Intergenic
988949704 5:36243581-36243603 CGCAAAATAACTATGGACAAAGG - Intergenic
989132497 5:38121755-38121777 CCCAATTAAAAAATGGACAAAGG - Intergenic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
989424871 5:41284798-41284820 TTTAATTAAAATATGGAAAAAGG + Intergenic
989519815 5:42388359-42388381 TTCAATAAAAATACTGACAGTGG - Intergenic
989548479 5:42702887-42702909 CCCAATTAAAAAATGGGCAAAGG - Intronic
990180952 5:53160054-53160076 CTCAATTCAAAAATGGGCAAAGG + Intergenic
990327540 5:54693189-54693211 TTCAATAGAAAAATGGGCAATGG + Intergenic
990567047 5:57040643-57040665 CCCAATTAAAAAATGGGCAAAGG - Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990847025 5:60153194-60153216 CCCTATTAAAATATTGACAAAGG + Intronic
991226576 5:64280149-64280171 CTCCATTAAAAAATGGGCAAAGG - Intronic
991328095 5:65460710-65460732 CACAATAAAAATATGGGCAGAGG + Intronic
991469699 5:66954898-66954920 CTCAAAAAAAAAAGGGAGAAAGG + Intronic
991684652 5:69170368-69170390 CTCAATAAATGTTTGAACAATGG + Intronic
991762031 5:69927652-69927674 TTCAATGAAAATATGACCAAAGG - Intergenic
991785298 5:70190448-70190470 TTCAATGAAAATATGACCAAAGG + Intergenic
991841259 5:70802701-70802723 TTCAATGAAAATATGACCAAAGG - Intergenic
991877744 5:71190851-71190873 TTCAATGAAAATATGACCAAAGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992252412 5:74888532-74888554 CCCAATAGAAAAATGGGCAAAGG - Intergenic
992345552 5:75873262-75873284 CCCAATGAAAATGTAGACAAAGG + Intergenic
992368549 5:76118457-76118479 CTCAATACAAAAATGGGAAAAGG + Intronic
992607671 5:78476068-78476090 TTCAATATAAATAGGGAAAAAGG - Exonic
992756951 5:79916266-79916288 CTCCATCAAAAAATGGGCAAAGG + Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993159277 5:84267834-84267856 CTCAGTAATAATTTGGCCAAAGG + Intronic
993208492 5:84918240-84918262 TTCAATTAAAAAATGGGCAAAGG + Intergenic
993236819 5:85321416-85321438 CCCAATTAAAAGATGGACAAAGG + Intergenic
993239498 5:85362847-85362869 CCCAATTAAAAAATGGGCAAGGG - Intergenic
993327021 5:86553143-86553165 CCCAATTAAAAAATGGGCAAAGG + Intergenic
993480266 5:88415703-88415725 GTCAATGGAAATATAGACAAAGG + Intergenic
993837231 5:92830305-92830327 ATCAATTAAAAAGTGGACAAAGG - Intergenic
994031110 5:95144231-95144253 TTCAATTAAAAAATGGGCAAAGG - Intronic
994577788 5:101602291-101602313 CACAATTACAAAATGGACAAGGG + Intergenic
994592758 5:101792483-101792505 GTTAGTAAAAATATGGACAGTGG - Intergenic
994765035 5:103904697-103904719 CTCCATTAAAAAATGGGCAAAGG + Intergenic
995160082 5:108968856-108968878 CCAAATAAAAATATTGGCAATGG + Intronic
995222517 5:109666687-109666709 GACAATAAAAATATGAAAAAAGG - Intergenic
995293654 5:110491141-110491163 CCCAATTAAAAAGTGGACAAAGG + Intronic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995766745 5:115627056-115627078 CTCCATAAATATATGTAAAATGG - Intronic
995802787 5:116017528-116017550 CACAATAAATAAAAGGACAAAGG - Intronic
996117826 5:119637580-119637602 TTTAAAAAAAAAATGGACAAGGG - Intergenic
996362141 5:122661357-122661379 CTAAATTAAAATGTGGGCAAAGG + Intergenic
996446557 5:123560042-123560064 CCCAATTGAAAAATGGACAAAGG + Intronic
996622067 5:125518308-125518330 CCCAATAAAAAGAGGGCCAAAGG - Intergenic
997017738 5:129956378-129956400 CTCCATTAAAAAGTGGACAAAGG - Intronic
997090568 5:130851669-130851691 CTCAATAGAAATATGGGCAAAGG - Intergenic
997171806 5:131729576-131729598 CTCAAAAAAAATATGTATATAGG - Intronic
997737718 5:136226417-136226439 CTCACTAAAACCATGCACAATGG + Intronic
997914517 5:137910938-137910960 CACCATAAAAATATTGAAAAAGG - Intronic
997937292 5:138124369-138124391 CCCAATTAAAAAATGGGCAAAGG - Intronic
997959842 5:138311869-138311891 CTCAATTAAAAAATGGGCAAAGG + Intronic
999072082 5:148754342-148754364 CTCATTTAAAAATTGGACAAAGG - Intergenic
999292522 5:150435734-150435756 CTCAAAAAAAAAAAGTACAATGG + Intergenic
999761519 5:154704809-154704831 CTCCATTAAAAAATGGACAAAGG + Intergenic
999962602 5:156772941-156772963 ATCAATACATATATGAACAAAGG + Intergenic
1000469193 5:161618986-161619008 TCCAATATAAACATGGACAAAGG + Intronic
1000526570 5:162366110-162366132 CCCATTAAAAAAATGGGCAAAGG + Intergenic
1000663203 5:163961879-163961901 CCCCATCAAAAAATGGACAAAGG - Intergenic
1000794902 5:165652953-165652975 CTGAAAAAAAATATGCACTAAGG - Intergenic
1001045483 5:168368307-168368329 CTCAATAAATATTTGTGCAATGG - Intronic
1001192702 5:169645445-169645467 CCCCATCAAAATGTGGACAAAGG - Intronic
1001537995 5:172512906-172512928 CCCAATTAAAAAATGAACAAAGG + Intergenic
1001678755 5:173540266-173540288 CCCAATGAAAAAATGGGCAAAGG + Intergenic
1001922931 5:175614825-175614847 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002830115 6:812767-812789 CTAAATAAAAAGATAGACAGGGG - Intergenic
1002832479 6:835338-835360 CCATATAAAAATATGGACAGTGG + Intergenic
1003405783 6:5826097-5826119 ATCAATTAAAAAATGGACACAGG + Intergenic
1003455025 6:6274218-6274240 CTCAATAAATATTTGGCAAATGG + Intronic
1003695082 6:8397353-8397375 CTCAATACATATTTGGTCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004795773 6:19082529-19082551 CTCAACAACAAAACGGACAAAGG + Intergenic
1004799406 6:19129834-19129856 CTCAATAACATTATTGAGAATGG + Intergenic
1005031090 6:21509818-21509840 CTCAATAAAAATCTGTTGAATGG - Intergenic
1005123374 6:22416676-22416698 CCTGATTAAAATATGGACAAAGG + Intergenic
1005435771 6:25810424-25810446 CCCAATTAAAAAATGGGCAAAGG + Intronic
1005528397 6:26676234-26676256 GACAAAATAAATATGGACAAGGG - Intergenic
1005529164 6:26685381-26685403 GACAAGATAAATATGGACAAGGG - Intergenic
1005530185 6:26696536-26696558 CCCAATTAAAACATGGAGAAAGG + Intergenic
1005540611 6:26805111-26805133 CCCAATTAAAACATGGAGAAAGG - Intergenic
1005541632 6:26816265-26816287 GACAAGATAAATATGGACAAGGG + Intergenic
1005542398 6:26825405-26825427 GACAAAATAAATATGGACAAGGG + Intergenic
1005795223 6:29353339-29353361 CTGAATAAATATATGAACATGGG - Intergenic
1005908530 6:30287360-30287382 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1006235777 6:32630493-32630515 CTCCATAAAAAAGTGGGCAAAGG - Intronic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1006841784 6:37033000-37033022 CTCAATAAAAATCTGGGGACTGG + Intergenic
1007734847 6:43974735-43974757 CTCATTAAAAAAATGGGTAAAGG - Intergenic
1008262345 6:49382083-49382105 CCCCATTAAAAAATGGACAAAGG - Intergenic
1008523656 6:52386014-52386036 CTCAATTAAAAAGTGGGCAAAGG + Intronic
1008710694 6:54223048-54223070 CTCAATTAAAAAATGGGCAAGGG - Intronic
1008774629 6:55022730-55022752 TTCAATTAAAAAATGGGCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009006031 6:57788163-57788185 TTCAATGAAAATATGACCAAAGG + Intergenic
1009011424 6:57847207-57847229 CCCAATTAAAACATGGAGAAAGG - Intergenic
1009012440 6:57858322-57858344 GACAAGATAAATATGGACAAGGG + Intergenic
1009013205 6:57867525-57867547 GACAAAATAAATATGGACAAGGG + Intergenic
1009038204 6:58143817-58143839 CTCAATTAAAAAATTGACAAGGG - Intergenic
1009569195 6:65360029-65360051 CCCAATAAAAATATTTTCAATGG + Intronic
1009595793 6:65734213-65734235 TTCAACAAAAATATGCACTAGGG - Intergenic
1009960227 6:70511104-70511126 CCCAATTAAAATATGGGGAAAGG - Intronic
1010050895 6:71503063-71503085 CTCAAAAGAAATATGGGCTAGGG + Intergenic
1010093296 6:72009618-72009640 CTCAATAAAAAAATGATAAAGGG + Intronic
1010200571 6:73278334-73278356 ATCAATAGAAATATAGGCAAAGG - Intronic
1010901081 6:81428346-81428368 CCCACTAAAAAAATGGCCAAAGG - Intergenic
1010914606 6:81600444-81600466 CCCCATAAAAATGTGGACAAAGG + Intronic
1010959109 6:82125003-82125025 CCCCATCAAAAAATGGACAAAGG - Intergenic
1011193627 6:84762208-84762230 CTAAATAAATACCTGGACAAGGG + Intronic
1011257566 6:85438718-85438740 CTCCATCAAAATGTGGGCAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011595807 6:89014720-89014742 CTCATTAAAAAAGTGGACAAAGG - Intergenic
1011600559 6:89056260-89056282 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1012232279 6:96774184-96774206 CCCAATTAAAAAGTGGACAAAGG + Intergenic
1012331251 6:97990945-97990967 CTCATGTAAAATAGGGACAATGG + Intergenic
1012420277 6:99057235-99057257 CTGATTCAAAATATGGAGAAGGG + Intergenic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012544276 6:100399115-100399137 CTCAATTCAAAAATGGGCAAAGG - Intronic
1012678392 6:102146706-102146728 CCCATTAAAAAAATGGGCAAAGG - Intergenic
1012934597 6:105353466-105353488 CTCAATAAAAATTAGCAAAATGG + Intronic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013507010 6:110810876-110810898 CCAAAAAAAAATATGGAAAAGGG - Intronic
1013848757 6:114487626-114487648 ATCCATTAAAAAATGGACAAAGG - Intergenic
1013952780 6:115804988-115805010 CTCATTAAAAAGTTGGGCAACGG + Intergenic
1014034029 6:116744593-116744615 CCCAATTAAAAAATGGACAAAGG - Intergenic
1014131217 6:117836272-117836294 ATCAATAAAAATGTAGAAAAAGG + Intergenic
1014247996 6:119087406-119087428 CCCAATTAAAATATGGACAAAGG + Intronic
1014656263 6:124108341-124108363 CCCAAGTAAAATATGGGCAAAGG - Intronic
1014716814 6:124875315-124875337 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015075809 6:129155924-129155946 CTATATACAAATATGGAAAATGG + Intronic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015242194 6:131037074-131037096 TACAATAAAAATATTGCCAAAGG + Intronic
1015284276 6:131467251-131467273 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1015459875 6:133477437-133477459 CTCAAATAAAAAATGGGCAATGG - Intronic
1015470946 6:133605602-133605624 CCCCATTAAAATATGGGCAAAGG - Intergenic
1015831979 6:137380254-137380276 TTCAATTAAAATATGGTCAAAGG + Intergenic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016006135 6:139091112-139091134 CTCAATAGAAACATGGCTAAGGG + Intergenic
1016106258 6:140166715-140166737 CCCAATTCAAAAATGGACAAAGG - Intergenic
1016289132 6:142508310-142508332 CCCAATTAAAAAATGGACAGAGG - Intergenic
1016297631 6:142591556-142591578 CCCTATAAAAAAATGGGCAAAGG - Intergenic
1016554473 6:145320295-145320317 TTCAATAGAAAAATGGACAGTGG - Intergenic
1016627129 6:146184564-146184586 CTCAATAAAAATTTAGTTAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1016970742 6:149759966-149759988 ATCAATGAAAATATGGTGAAAGG - Intronic
1017401063 6:154063470-154063492 ATCAATAAAAATATGAATTAGGG - Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018582677 6:165320942-165320964 CCCACTAAAAAAATTGACAAAGG - Intergenic
1019208196 6:170380670-170380692 CCCAATTAAAACATGGGCAAAGG - Intronic
1019755652 7:2767060-2767082 CCCAATTAAAAAATGGGCAAAGG - Intronic
1019861449 7:3662186-3662208 CTCAATAACAATAGGTAAAATGG + Intronic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1019969708 7:4530530-4530552 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1019989096 7:4680116-4680138 CTCTATAAAAAAATTGAAAAAGG + Intergenic
1020494371 7:8830004-8830026 CTCAATTCAAATATAGGCAAAGG - Intergenic
1020545543 7:9524637-9524659 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1020772411 7:12411386-12411408 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1020995772 7:15262086-15262108 TTCAATAAAAGTAGTGACAATGG - Intronic
1021002022 7:15342586-15342608 CTCAATAAAAATGTTCAGAATGG + Intronic
1021061538 7:16118594-16118616 ATCAATAAAATGTTGGACAAAGG + Intronic
1021204926 7:17768749-17768771 TTTAATTAAAAGATGGACAAAGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021404839 7:20253080-20253102 CCCAATTAAAATATGGGCAAAGG + Intergenic
1021419380 7:20428188-20428210 CCCCATTAAAATATGGGCAAAGG + Intergenic
1021606841 7:22416650-22416672 CTCAATAAAAAAATGGGTAAAGG + Intergenic
1021775111 7:24046486-24046508 TTCAATGGAAAAATGGACAAAGG + Intergenic
1021826649 7:24559987-24560009 CCCAACAGAAATATGGCCAAGGG - Intergenic
1022781012 7:33583226-33583248 ATAAATAAAAATAGGGAGAAAGG - Intronic
1022788896 7:33666828-33666850 CTCAATTAAAACATAGGCAAAGG - Intergenic
1023270234 7:38454916-38454938 CTCAATAAAATTAAGTAGAAAGG + Intronic
1023288075 7:38639950-38639972 CCCATTTAAAAAATGGACAAAGG + Intergenic
1023289073 7:38650530-38650552 CCCAATCAAAAAGTGGACAAAGG + Intergenic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023884823 7:44346979-44347001 TCCAATCAAAATATGGGCAAAGG - Intergenic
1024020943 7:45368430-45368452 CTCAACTAAAAAATGTACAAAGG - Intergenic
1024066041 7:45737376-45737398 CTCCATCAAAAAATGGGCAAAGG + Intergenic
1024348189 7:48334633-48334655 TTCAATAAAAATAGGGATAGAGG - Intronic
1024616727 7:51121342-51121364 CTCAATTAAAAAATGAGCAAAGG - Intronic
1024844809 7:53630808-53630830 CTCAATAAATATTTAGGCAAGGG + Intergenic
1024967858 7:55040221-55040243 CTCAAGAAAAATATGAAAAGTGG + Intronic
1025195696 7:56930874-56930896 CTGAATTAGAATATGGGCAAAGG - Intergenic
1025270240 7:57505097-57505119 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1025676253 7:63646065-63646087 CTGAATTAGAATATGGGCAAAGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1027650029 7:80855006-80855028 ATCAATAAAAGAATTGACAAGGG - Intronic
1027671765 7:81108717-81108739 CTCAGTAAAAATATGCAGAATGG - Intergenic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027812448 7:82921899-82921921 CTTATTAAAAAAATGGTCAAAGG + Intronic
1028170388 7:87588967-87588989 CCCAATAAAAAGATGGGCAAAGG - Intronic
1028319362 7:89440062-89440084 CTCTATAAAAGAATGGACACAGG - Intergenic
1028383948 7:90231893-90231915 ATAAATCAAAATATGGAAAATGG + Intronic
1028541680 7:91949089-91949111 CCCAATTAAAAAATGGGCAAGGG - Intronic
1028572091 7:92301512-92301534 CTCAATTAAAAAATGGGCAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029673947 7:102053263-102053285 CTGAATTAGAATATGGGCAAAGG - Intronic
1029848360 7:103437104-103437126 CACAATTAAAAAATGGGCAAAGG + Intronic
1030098009 7:105918532-105918554 CCCAATTAAAAAATGGGCAAAGG - Intronic
1030513724 7:110516453-110516475 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1030722088 7:112882311-112882333 CTCAAGCAAAACTTGGACAAAGG + Intronic
1030922092 7:115403804-115403826 CCCTATCAAAAAATGGACAATGG + Intergenic
1031099379 7:117460637-117460659 CTAAATAAAAAGAAAGACAAAGG - Intergenic
1031155173 7:118101512-118101534 CTCCATTAAAATATGGGCAAAGG - Intergenic
1031315536 7:120253831-120253853 CTCAATAAATGTATGGTGAAAGG + Intergenic
1031322262 7:120346162-120346184 CACAATTAAAAAATGGCCAAAGG - Intronic
1031469489 7:122152102-122152124 TTAAAAAAAAAAATGGACAAAGG - Intergenic
1031562184 7:123251721-123251743 CTCAATAAAGATTTGTAGAATGG - Intergenic
1031651157 7:124291364-124291386 CTCAATTAGAAAATGGCCAAAGG - Intergenic
1032041833 7:128569548-128569570 CCCAATGAAAAAATGGGCAAAGG - Intergenic
1032184386 7:129711452-129711474 CTAAAGAAAAATATGGAAAGTGG - Intronic
1032813023 7:135442238-135442260 CTAAATGAAAATTTGGGCAAGGG - Intronic
1033571616 7:142634684-142634706 CCAAAAAGAAATATGGACAAAGG + Intergenic
1033581090 7:142736503-142736525 GGCAATATAAATATGCACAAGGG - Intergenic
1033673498 7:143515077-143515099 CTCAAGAAAAATGTCAACAAAGG - Intergenic
1034354197 7:150438669-150438691 CCCAATAAAAAATTGGGCAAAGG + Intergenic
1034545844 7:151788503-151788525 CCCAATTAAAAAATGGGCAAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035088702 7:156285780-156285802 TACAAAAAAAATATGGAAAAAGG + Intergenic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1035882598 8:3258263-3258285 CCCCATTAAAACATGGACAAAGG + Intronic
1037385043 8:18330343-18330365 CCCATTAAAAAAATGGGCAAAGG + Intergenic
1037457299 8:19076100-19076122 CTCAATAAAAATACGGTGGAAGG + Intronic
1037497210 8:19451340-19451362 CTCAATAACAATATGGGAAGAGG - Intronic
1037782921 8:21883211-21883233 CCCAATTCAAAAATGGACAAAGG + Intergenic
1038243433 8:25831440-25831462 CTCAACAAAAAAATTGACCACGG - Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038357688 8:26845256-26845278 CCCAATTAAAAAATGGGCAAAGG + Intronic
1038468483 8:27789373-27789395 GGCAATAAAAATAGGGAAAAAGG - Intronic
1038656207 8:29454507-29454529 CTCCATCAAAAAATGGGCAAAGG + Intergenic
1038829229 8:31038395-31038417 CTCAATTAAAAAATGGGCAAAGG - Intronic
1039158541 8:34590700-34590722 CCCAACAAAAATATGAGCAAAGG - Intergenic
1039408812 8:37334950-37334972 CTCAACAAAAGTATGGGCACCGG + Intergenic
1039428894 8:37510341-37510363 CTTAATAAGAATATTTACAAAGG + Intergenic
1039686625 8:39809697-39809719 ACCAATGAAAATATGGAGAATGG - Intronic
1040056344 8:43060920-43060942 TTTAATCAAAAAATGGACAAAGG + Intronic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1040633342 8:49241378-49241400 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1040717789 8:50279259-50279281 ATCAATAAACATGTGGAAAATGG + Intronic
1040994037 8:53383242-53383264 CTCAATCAAAAAATGGGCAAAGG + Intergenic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041480944 8:58318882-58318904 TTCAATAAATAAATGAACAAAGG + Intergenic
1041560291 8:59209914-59209936 CTCAATTAAAACATGGGTAAAGG - Intergenic
1041621677 8:59977040-59977062 CTCAGCAAAAAGATGGACAGGGG - Intergenic
1042074262 8:64972441-64972463 CCCAATGAAAAAATGGACAAAGG - Intergenic
1042078503 8:65022739-65022761 TCCAATTAAAAAATGGACAAAGG + Intergenic
1042116747 8:65440585-65440607 CTCAATAAAAATGAGTAGAAAGG - Intergenic
1042901057 8:73728023-73728045 CTCAACTAAAAAATGGGCAAAGG - Intronic
1043214121 8:77563909-77563931 CTCCATAAAAAATTGGGCAATGG + Intergenic
1043223394 8:77694540-77694562 CCCCATCAAAAAATGGACAAAGG - Intergenic
1043224636 8:77710039-77710061 CCCCATCAAAAAATGGACAAAGG + Intergenic
1043310890 8:78858473-78858495 AACAATAAAAGGATGGACAAAGG + Intergenic
1043331926 8:79127893-79127915 CTCAATAAAGATAAGAATAATGG + Intergenic
1043539835 8:81248499-81248521 CCCAATTATAAAATGGACAAAGG + Intergenic
1043559954 8:81480902-81480924 TTCAACAAAAATATGTATAAAGG + Intronic
1043754984 8:83992145-83992167 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1043953917 8:86340175-86340197 CTCAGTAAGAAAATGGACAAAGG + Intergenic
1044086583 8:87949797-87949819 CCCCATTAAAAAATGGACAAAGG + Intergenic
1044107094 8:88223014-88223036 CTCCATCAAAAAATGGGCAAAGG + Intronic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044447089 8:92291563-92291585 CCCCATTAAAATGTGGACAAAGG - Intergenic
1044523790 8:93229399-93229421 CTCTATGAAAATTTGGATAAAGG + Intergenic
1044678766 8:94755882-94755904 CTCAAAAAAAAAAAGGACAATGG + Intronic
1044783256 8:95765765-95765787 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1044920050 8:97159981-97160003 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1045285338 8:100785864-100785886 GTAAAAAAAAATATGGAAAAGGG + Intergenic
1045639988 8:104238969-104238991 CTCAATGTCAATATGGAAAATGG - Intronic
1045760636 8:105602353-105602375 GTCAATATAAATATGGAGCATGG + Intronic
1045922808 8:107552126-107552148 CCCCATTAAAATATGGGCAAAGG + Intergenic
1045967768 8:108045245-108045267 CTCCATTAAAAAATGGGCAAAGG + Intronic
1046155545 8:110285139-110285161 ATCAATAAAAATATTAATAAAGG - Intergenic
1046684744 8:117212628-117212650 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1046726623 8:117681974-117681996 CTCAATAAATCTCTGTACAAGGG + Intergenic
1047106834 8:121741256-121741278 CTCAAAAAAAATCCTGACAATGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047555549 8:125925267-125925289 CTCAATAAATATATGTTGAATGG - Intergenic
1047572826 8:126119137-126119159 CCCAATTAAAAAATGGGCAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049044111 8:140136149-140136171 CTTAAAAAAAAAATAGACAAGGG + Intronic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050041747 9:1503141-1503163 GCCAATTAAAATATAGACAAAGG + Intergenic
1050108565 9:2191292-2191314 CTCAATAAAAAAGATGACAAAGG + Exonic
1050530342 9:6582880-6582902 CCCAATTAAAAAATGGGCAAAGG + Intronic
1050678216 9:8080284-8080306 CTCCATCAAAAACTGGACAAAGG - Intergenic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051201585 9:14632766-14632788 CCCAATTAAAACATGGTCAAAGG + Intronic
1051319187 9:15882077-15882099 GCCAGTAAAAATATGGAGAAAGG - Intronic
1051370843 9:16357822-16357844 CTCTGTAAAAATAAGGATAATGG + Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1051793405 9:20835052-20835074 CTCAATTAAAATAGAGACCAAGG - Intronic
1051832850 9:21299663-21299685 CTCAATAAAATACTGGCCAACGG - Intergenic
1051848553 9:21480613-21480635 CACAATAGAAATATGGTGAAAGG - Intergenic
1051996472 9:23223757-23223779 CCCCATCAAAATATGGGCAAAGG - Intergenic
1052073857 9:24116959-24116981 CAGAATAAAAATGTGGAGAAGGG - Intergenic
1052099850 9:24432364-24432386 CTCATTAAAAATGTGAACTATGG - Intergenic
1052310024 9:27057037-27057059 GTCAATATATATATTGACAAGGG - Intronic
1052322030 9:27177789-27177811 CCTGATAAAAAAATGGACAAAGG - Intronic
1052393124 9:27904620-27904642 GCCATTAAAAATGTGGACAATGG - Intergenic
1052508926 9:29389745-29389767 CACAATGAAAATATGAGCAAAGG - Intergenic
1052581829 9:30366747-30366769 CTCCATTAAAAGATGGGCAAAGG - Intergenic
1052581974 9:30369124-30369146 CCCAATTAAAAAATGGTCAAAGG - Intergenic
1052884144 9:33626920-33626942 CCAAAAAGAAATATGGACAAAGG + Intergenic
1052899719 9:33781991-33782013 GGCAATATAAATATGCACAAGGG - Intronic
1053436483 9:38078583-38078605 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053784034 9:41638793-41638815 CTGAAGAAAAATAAGGATAAGGG - Intergenic
1054171990 9:61848929-61848951 CTGAAGAAAAATAAGGATAAGGG - Intergenic
1054446850 9:65377946-65377968 CTGAAGAAAAATAAGGATAAGGG - Intergenic
1055378577 9:75680080-75680102 CTCAATTAAAAAAGGGACCAAGG + Intergenic
1056011675 9:82337747-82337769 CTCAATCAAAAAATGAGCAAAGG - Intergenic
1056378816 9:86039113-86039135 CTCAATTAAAAAATGAGCAAAGG + Intronic
1056421200 9:86428034-86428056 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1057730870 9:97607163-97607185 CTCAAAAAATATATATACAAAGG + Intronic
1057846075 9:98525323-98525345 CCCAATTAAAAATTGGACAAAGG + Intronic
1058109949 9:101021488-101021510 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1058192072 9:101930330-101930352 CTTGATTAAAATATGGGCAAAGG + Intergenic
1058207754 9:102129667-102129689 CACAATAAAAAAATGGTAAAGGG - Intergenic
1058232967 9:102453191-102453213 CTCAAATAAAATAATGACAATGG - Intergenic
1058508346 9:105689385-105689407 CTCAAAAAAAATAAAGAGAAAGG - Intergenic
1058916663 9:109573494-109573516 CTCTATTAAAAAATGGGCAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059207717 9:112482441-112482463 CTCAAAAAAAAAAAGGAAAAAGG - Intronic
1059510844 9:114844852-114844874 CTCTTTAAAAAAATGGGCAAAGG + Intergenic
1059979481 9:119754459-119754481 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1060490993 9:124084025-124084047 CTCAATGAAAAACTGGGCAAAGG - Intergenic
1060991351 9:127851134-127851156 CTCAAAAAAAATAGAGAAAAGGG - Intronic
1061164040 9:128912221-128912243 CTCAAAAAACATCTGCACAAAGG - Intronic
1061290302 9:129646875-129646897 ACCAATAAAAACATGGGCAAAGG + Intergenic
1061640477 9:131950821-131950843 CTCAATAAACATGTGGTGAACGG + Intronic
1203371522 Un_KI270442v1:310350-310372 CTCCATTAAAACATTGACAAGGG + Intergenic
1185684179 X:1914490-1914512 CTAAATAAAAATATTTACAAAGG + Intergenic
1185986472 X:4840423-4840445 CCCAATTAAAATACAGACAAAGG - Intergenic
1185987146 X:4847724-4847746 CCCCATCAAAATATGGGCAAAGG + Intergenic
1186037379 X:5439291-5439313 TCAAATAAAAATATGGAGAAAGG - Intergenic
1186208779 X:7228551-7228573 CCCAATTAAAAAATGGCCAAAGG - Intronic
1186392356 X:9173718-9173740 CCCCATTAAAAAATGGACAAAGG + Intergenic
1186635902 X:11404645-11404667 CTCAAAGAAAATGTGGCCAAAGG + Intronic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187326886 X:18299209-18299231 CTTAATTAAAAAGTGGACAAAGG + Intronic
1187464894 X:19518312-19518334 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1187474570 X:19599753-19599775 CTAAATAAAAATCAGGACCAGGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187571116 X:20503258-20503280 CACAATTAAAAAATGGGCAAAGG - Intergenic
1188047607 X:25445681-25445703 CTCCATCTAAAAATGGACAAAGG + Intergenic
1188209945 X:27410366-27410388 CTGAAGAAGAATATGGCCAAAGG + Intergenic
1188236141 X:27733353-27733375 CCGAATTAAAATATGGCCAAAGG - Intronic
1188398038 X:29709041-29709063 CCCAATTAAAATATGGACAAAGG - Intronic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1188891826 X:35620998-35621020 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1188941053 X:36238013-36238035 CCCTATAAAAAAATGGGCAAAGG - Intronic
1189059113 X:37733661-37733683 CCCAATTAAAAGATGGGCAAAGG - Intronic
1189101585 X:38196031-38196053 ATCAGTAAAAATATGGAGTATGG + Intronic
1189404276 X:40705477-40705499 GTAAAGAAAAATATGGACATTGG - Intronic
1189448647 X:41105947-41105969 CTCAATTGAAAAATGGGCAAAGG - Intronic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189699718 X:43705776-43705798 CCCAATTCAAAAATGGACAAAGG + Intronic
1189718406 X:43888526-43888548 CTCAATTAAAAAATGAGCAAAGG - Intergenic
1189742761 X:44137591-44137613 TTCAATCAAAAAGTGGACAAAGG + Intergenic
1189954762 X:46266214-46266236 CTAAATAAGAAAATGGCCAAAGG + Intergenic
1190518334 X:51248445-51248467 CCCCATCAAAAAATGGACAAAGG + Intergenic
1190609107 X:52176085-52176107 CTCCATCAAAAAATGGGCAAAGG + Intergenic
1190616190 X:52235312-52235334 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1190693239 X:52929917-52929939 CCCCATAAAAAAATGGTCAAAGG + Intronic
1190813240 X:53905476-53905498 CACAATCAAAACATGGGCAAAGG - Intergenic
1190871186 X:54426013-54426035 CCCAATAGAAAAATGGCCAAGGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191683711 X:63867323-63867345 GCCAATGAAAAAATGGACAAAGG - Intergenic
1191708333 X:64117741-64117763 CCCAATTAAAAAGTGGACAAAGG - Intergenic
1191769947 X:64744081-64744103 CTCAATTATAAAATGGGCAAAGG - Intergenic
1191822045 X:65321206-65321228 CTCAATTAAAAAGTGGACAAAGG + Intergenic
1192281131 X:69687238-69687260 CTCAATTGAAAAATGGGCAAAGG - Intronic
1192302269 X:69917318-69917340 GTAAATAAGAATATGGTCAATGG - Intronic
1192533155 X:71906911-71906933 CTCAATAAAAATATATATACAGG - Intergenic
1192737052 X:73859294-73859316 CTCAATTAAAAAATGGGCACAGG - Intergenic
1192902822 X:75518298-75518320 CCCATTTAAAAAATGGACAATGG + Intronic
1193017629 X:76753708-76753730 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193308903 X:79981808-79981830 CTCATGAAAAAAATGGGCAAAGG - Intergenic
1193464087 X:81826101-81826123 CCCCATTAAAATGTGGACAAAGG - Intergenic
1193523747 X:82563194-82563216 CTCCATTAAAAAATGGTCAAAGG + Intergenic
1193575951 X:83195365-83195387 CTCATTAAAAAACTGGGCAAAGG - Intergenic
1193622069 X:83765864-83765886 CCCCATTAAAAAATGGACAAAGG - Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1193837025 X:86355855-86355877 CCCCATTAAAAAATGGACAAAGG - Intronic
1193840504 X:86403349-86403371 CTTCATTAAAAAATGGACAAAGG + Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194123095 X:89984508-89984530 CTCAATTAAAATTTGGGCAAAGG - Intergenic
1194238384 X:91413129-91413151 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1194562771 X:95443672-95443694 CCCAATTCAAATATGGACAAAGG - Intergenic
1194597836 X:95880916-95880938 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1194652171 X:96529028-96529050 CCCAAATAAAAAATGGACAAAGG + Intergenic
1194678536 X:96822888-96822910 CCTAATAGAAATATGAACAAAGG + Intronic
1194830189 X:98614101-98614123 CTCCATAAAAAAGTGGGCAAAGG - Intergenic
1194904119 X:99552355-99552377 TTCAATTTAAATATCGACAAAGG - Intergenic
1194958590 X:100209627-100209649 CCCCATCAAAATATGGGCAAAGG - Intergenic
1195046562 X:101059724-101059746 CTCAATAAAGACTTTGACAAAGG + Intergenic
1195145724 X:102015147-102015169 TGCAATTAAAAAATGGACAAAGG + Intergenic
1195283334 X:103358069-103358091 ATAAGTAGAAATATGGACAAAGG - Exonic
1195590249 X:106616449-106616471 TACAAGAAAAATATGAACAAAGG - Intronic
1195610213 X:106858230-106858252 CTCCATAAAAAAGTGGGCAAAGG - Intronic
1195827299 X:109015994-109016016 CCCCATCAAAAAATGGACAAAGG + Intergenic
1195848086 X:109249984-109250006 CCCAATTAAAAAATGGGCAATGG - Intergenic
1195920936 X:109982960-109982982 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1196029293 X:111077973-111077995 CCCAATTAAAAAATGGAAAAAGG + Intronic
1197160360 X:123316223-123316245 ATCACTAAAAAGTTGGACAAAGG + Intronic
1197180427 X:123529846-123529868 CTCAATTAAAAAGTGGGCAAAGG - Intergenic
1197662220 X:129186624-129186646 CTCCATAAAAATATGGAATTCGG - Intergenic
1197813474 X:130472165-130472187 CCCTATAAAAAAGTGGACAAAGG + Intergenic
1198164724 X:134043626-134043648 TTCAATTAAAAGATGGGCAAAGG - Intergenic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1198541938 X:137649110-137649132 CCCAATTAAAAAGTGGACAAAGG + Intergenic
1199205873 X:145147300-145147322 CCCAATTAAAAAATGGACAAAGG - Intergenic
1199800078 X:151241718-151241740 CTCAATAGAAATGTGGACAAAGG + Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200125689 X:153813321-153813343 CTCAAGAAGAACATGGGCAAAGG + Intronic
1200307334 X:155040836-155040858 CCCAATTAAAAAATGGGCAAAGG - Intronic
1200354085 X:155529671-155529693 CCCAATTAAAAAATGGTCAATGG - Intronic
1200363867 X:155640034-155640056 CTCAATTAAAAAGTGGGCAAAGG - Intronic
1200475953 Y:3641954-3641976 CTCAATTAAAATTTGGGCAAAGG - Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201384814 Y:13428032-13428054 CCCCATAAAAATTTGGGCAAAGG - Intronic
1201579757 Y:15498869-15498891 CCCAGTTAAAAAATGGACAAAGG - Intergenic
1201854338 Y:18524590-18524612 CACAGTAAAAAAAAGGACAATGG + Intergenic
1201878983 Y:18795795-18795817 CACAGTAAAAAAAAGGACAATGG - Intronic
1202052263 Y:20793422-20793444 CCCAATAAAAAAGTGGGCAAAGG - Intergenic
1202065940 Y:20940191-20940213 CTCAATAAAATACTGGAAAACGG - Intergenic