ID: 1026450586

View in Genome Browser
Species Human (GRCh38)
Location 7:70525828-70525850
Sequence GAGATGGGCACCTCCAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 441}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026450582_1026450586 1 Left 1026450582 7:70525804-70525826 CCTGGAGGAGGGCACTCGAGTGA 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG 0: 1
1: 0
2: 2
3: 61
4: 441
1026450576_1026450586 23 Left 1026450576 7:70525782-70525804 CCCACAGAAGTGAGAGAGGTGGC 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG 0: 1
1: 0
2: 2
3: 61
4: 441
1026450577_1026450586 22 Left 1026450577 7:70525783-70525805 CCACAGAAGTGAGAGAGGTGGCC 0: 1
1: 0
2: 4
3: 22
4: 225
Right 1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG 0: 1
1: 0
2: 2
3: 61
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026450586 Original CRISPR GAGATGGGCACCTCCAGCCT TGG Intronic
900250339 1:1665490-1665512 GAAGTGGGCACCCCCAGCATGGG + Exonic
900389771 1:2428875-2428897 GGGCTGGGCACCACCAGGCTTGG + Intronic
900393658 1:2444389-2444411 CAGATGAGCACCTGCAGCCCAGG - Intronic
900939710 1:5790685-5790707 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
901220459 1:7580669-7580691 GTGCTGGGCACAGCCAGCCTCGG - Intronic
901252448 1:7790920-7790942 GAGGTGGGCTCCTACAGCCTTGG + Intronic
901586755 1:10301615-10301637 GAGATCGGGCACTCCAGCCTGGG + Intronic
901619064 1:10567236-10567258 GAGATGGGAAACTACAGCCAGGG - Intronic
902530941 1:17090322-17090344 GAGATGAGCACCCCAAGGCTGGG + Intronic
902816623 1:18919876-18919898 CAGCTGGGCACCTGCAGCCAGGG + Intronic
903774189 1:25782374-25782396 GAGTGTGGCCCCTCCAGCCTGGG + Intronic
904469899 1:30729802-30729824 GAGCTGGGCACCACCATCCGAGG + Intergenic
907343964 1:53758946-53758968 AAGGTGGGCTCCCCCAGCCTTGG + Intergenic
908746775 1:67383899-67383921 GAGGTGGGCTCCCACAGCCTTGG + Intronic
908967781 1:69787183-69787205 GAGGTGGGCTCCCACAGCCTTGG + Intronic
909083761 1:71147274-71147296 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
909352016 1:74665168-74665190 AAGATGGCCATCTGCAGCCTGGG + Intronic
910520210 1:88112519-88112541 CAGATGGGCACCACCTGCATTGG + Intergenic
911812159 1:102296334-102296356 GAGCTGGGCTCCCACAGCCTTGG - Intergenic
912052006 1:105541571-105541593 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
912117698 1:106427250-106427272 GAGGTGGGCTCCTACAGCCTTGG - Intergenic
912495734 1:110089963-110089985 GAGATGGGCCTCTCCTGTCTTGG + Intergenic
912755211 1:112318806-112318828 GTGTTGGGCATATCCAGCCTGGG - Intergenic
913208387 1:116563231-116563253 GAGATGGGCTCCCACAACCTTGG + Intronic
913289391 1:117258459-117258481 GAGGTGGGCTCCTGCAGCCTTGG + Intergenic
914755375 1:150559097-150559119 GACATGCGCGCCTGCAGCCTGGG + Exonic
916213751 1:162378930-162378952 GAGAGTGTCACCTCCTGCCTGGG - Exonic
916777914 1:167988370-167988392 GAGTTTGACACCACCAGCCTAGG - Intronic
917663815 1:177204293-177204315 GAGATTCACACCTCCACCCTAGG - Intronic
918303457 1:183224915-183224937 GAGATGATCACATCCAGCCAGGG - Intronic
918591343 1:186244970-186244992 GAGATGGGCTCCTACAGCTTTGG + Intergenic
918619314 1:186584070-186584092 GAGGTGGGCTCCTATAGCCTTGG - Intergenic
919179164 1:194059281-194059303 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
919809990 1:201402938-201402960 GAGATGGTCACCAGCATCCTTGG + Intergenic
919844025 1:201629586-201629608 GAGATGGACCCATCCAGCCTAGG - Intronic
920647362 1:207813515-207813537 GAGATGCACACATCCATCCTGGG + Intergenic
920900669 1:210107149-210107171 GAGATGGGCTCCCACAGCCTTGG + Intronic
921169396 1:212533110-212533132 GAGAAGGCAACCTTCAGCCTGGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
921674789 1:217965498-217965520 CAGCTGGGCACCTGCAGCCTGGG + Intergenic
922245904 1:223797459-223797481 GAGATGGTGCACTCCAGCCTGGG - Intronic
922729408 1:227942061-227942083 GAGCAGGGCACCCCCAGCCCGGG + Intronic
923878309 1:238075128-238075150 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1063008421 10:1997279-1997301 CCCCTGGGCACCTCCAGCCTTGG - Intergenic
1063025837 10:2178293-2178315 GTGATGGGAACCTCCAGATTAGG - Intergenic
1063809039 10:9682016-9682038 GAGATGGGCTCCTATGGCCTTGG - Intergenic
1063843151 10:10094027-10094049 GAGTTGGGCACCATCATCCTTGG - Intergenic
1064126373 10:12664600-12664622 GAGATTGGCACCTGCAGCCCTGG - Intronic
1066262799 10:33745475-33745497 AAGATCAGCACCTCCAGCATGGG + Intergenic
1068042412 10:51841823-51841845 TAGATGTGCACCTCCAGGCCTGG + Intronic
1069159844 10:65079865-65079887 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1069662895 10:70135402-70135424 GAGATGGGCCACACCAGCCCTGG - Intergenic
1072313808 10:94182406-94182428 CAGATGTGCACCACCACCCTTGG + Intronic
1072866436 10:99067140-99067162 GAGGTGGGCTCCCACAGCCTTGG + Intronic
1073792609 10:106955350-106955372 GGGGTGGGCAGCTCCAGCATTGG - Intronic
1074225669 10:111481710-111481732 GGGATTGGCACCTGCAGCCTGGG + Intergenic
1075157341 10:119989196-119989218 TGGATGGGCAACTCCACCCTTGG + Intergenic
1075484939 10:122814281-122814303 GAGATGGGGACCCCCGGCCCTGG - Intergenic
1075530492 10:123225079-123225101 GAGATGGGCTCCCACAGTCTTGG + Intergenic
1075818871 10:125288203-125288225 GATTTGGGAATCTCCAGCCTGGG + Intergenic
1075861799 10:125683468-125683490 GACAAGGTCACCCCCAGCCTGGG - Intergenic
1076194863 10:128510603-128510625 GAGATGTGCAGCTACAGCCAAGG + Intergenic
1076343517 10:129765667-129765689 GAGATGGTCAGCCCCTGCCTTGG - Intronic
1076694213 10:132239342-132239364 GAGATGGGCTCCCCCAGCTTGGG - Intronic
1077018152 11:406085-406107 GAGGTGGCCACCCACAGCCTTGG + Intronic
1077359754 11:2135576-2135598 GGGAGGGGCACCTCTGGCCTGGG - Intronic
1077406158 11:2383409-2383431 GTGAACGGCCCCTCCAGCCTGGG - Intronic
1077412448 11:2410008-2410030 TAGACGGGCGCCTCCAGCCAGGG - Intronic
1078515028 11:12014584-12014606 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1078667458 11:13338662-13338684 GATATGCCCACCTCCAGGCTGGG - Intronic
1078834917 11:15017867-15017889 GAGGTGGGCTCCCACAGCCTTGG - Intronic
1079750477 11:24190759-24190781 GAGGTGGGCTCCTCCAGATTTGG + Intergenic
1081909566 11:46692268-46692290 GAGATGCCTACCACCAGCCTGGG + Intronic
1082787268 11:57324121-57324143 GGGCTGGGCAGCTCCAGCCCCGG + Intronic
1083331476 11:61900395-61900417 GAGAGGGGCACCCGCAGGCTGGG + Intronic
1083428619 11:62602268-62602290 GAGCCGGGCAGCCCCAGCCTAGG - Exonic
1084461394 11:69298493-69298515 GGGATGTCCACCTGCAGCCTCGG - Intronic
1084468314 11:69340302-69340324 CAGATGGGCTCCTCCAAACTGGG + Intronic
1084607776 11:70182460-70182482 GTGAGGGGGACCCCCAGCCTGGG - Intronic
1085704077 11:78770436-78770458 AAGATGAGCACCTCCTTCCTTGG + Intronic
1087046765 11:93849834-93849856 GCGAGGACCACCTCCAGCCTGGG + Intronic
1087480464 11:98693605-98693627 GAGTTGGGCTCCTACAGCTTTGG - Intergenic
1087831668 11:102825869-102825891 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1089462556 11:118661607-118661629 GGGCCAGGCACCTCCAGCCTAGG - Intronic
1090028353 11:123186434-123186456 TAGAAGGGCACCTCTTGCCTAGG + Intronic
1090785400 11:130043798-130043820 GCCTTGGGCAGCTCCAGCCTGGG - Intergenic
1091384747 12:86173-86195 GAGGTGGGCGCTTCCGGCCTAGG + Intronic
1092009312 12:5096411-5096433 GAGAGAGGCATCTCCAGCCCTGG + Intergenic
1095039760 12:37427819-37427841 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG + Intergenic
1098285463 12:68902736-68902758 GAGATGGGCTCAGACAGCCTGGG + Intronic
1098713726 12:73801741-73801763 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1098741509 12:74178884-74178906 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1099214660 12:79839074-79839096 GAGGTGGGCTCCCACAGCCTTGG - Intronic
1099413751 12:82361822-82361844 GAGAGAGCCAGCTCCAGCCTCGG + Intronic
1099501515 12:83419369-83419391 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1100674819 12:96855654-96855676 GAGGTGGGCCCCCACAGCCTTGG + Intronic
1101033773 12:100685263-100685285 GAGATGGGCTCCCACAGCCTTGG + Intergenic
1101846564 12:108367717-108367739 CAGATGGGCAGCTCCGGCCATGG + Intergenic
1102160586 12:110765549-110765571 GAGATGGGATCTCCCAGCCTGGG + Intergenic
1103069585 12:117930085-117930107 GAGTTGAGGCCCTCCAGCCTGGG - Intronic
1103282659 12:119772745-119772767 GAGCAGGGAACCTCCAGCCCAGG - Intronic
1103447089 12:121001509-121001531 GACTTGGGCACCCCCAGCCTGGG + Exonic
1104948790 12:132429443-132429465 GACCTGGGAACTTCCAGCCTGGG - Intergenic
1105380922 13:19886689-19886711 CACCTGGGCAACTCCAGCCTGGG - Intergenic
1105502849 13:20988234-20988256 GAGGCGGGCACCTCCGGTCTGGG + Exonic
1107188427 13:37550219-37550241 GAGGTGGGCTCCCACAGCCTCGG - Intergenic
1107627200 13:42301094-42301116 GAGAAGGGCACTTCCTGCCAAGG - Exonic
1107673170 13:42767933-42767955 GTCAAGGTCACCTCCAGCCTAGG + Intergenic
1110251466 13:73385192-73385214 GAGAAGGGAACATCCAGCATGGG + Intergenic
1111358831 13:87146639-87146661 GAGTTGGGCTCCCACAGCCTTGG - Intergenic
1111614262 13:90643648-90643670 GAGGTGGGCTCCTACAGCCTTGG + Intergenic
1111990446 13:95111322-95111344 CAGATGTGCACTGCCAGCCTTGG + Intronic
1112769762 13:102782293-102782315 GAGGTGGGCTCCGACAGCCTTGG - Intergenic
1112995994 13:105575615-105575637 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1113521682 13:110946293-110946315 GAGATGGGCACCAGCAGGATTGG + Intergenic
1113708232 13:112447563-112447585 TAGCTGGGCACCTCCTGCCCAGG - Intergenic
1113960265 13:114122230-114122252 GAGCTTGGCACCTACAGACTGGG + Intronic
1114171139 14:20273380-20273402 GAGGTGGGCTCCCACAGCCTTGG - Intronic
1114421341 14:22586155-22586177 GAGATGGCGCACTCCAGCCTGGG + Intronic
1114780393 14:25532690-25532712 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1115010661 14:28540708-28540730 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1115249320 14:31329551-31329573 GAGGTGGGCTCCTACAGCCTTGG + Intronic
1115608992 14:35034149-35034171 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1116079617 14:40155988-40156010 GAGGTGGGCTACTTCAGCCTTGG + Intergenic
1118070956 14:62246091-62246113 GAGGTGGGTTCCTACAGCCTTGG - Intergenic
1118135380 14:63019885-63019907 GAAATGGAAACCTACAGCCTGGG + Intronic
1118612381 14:67551831-67551853 GGGATTGGCCACTCCAGCCTGGG + Intronic
1119386023 14:74258565-74258587 GAGAAGGGAACCGCCAGGCTTGG + Intronic
1122375995 14:101257718-101257740 GTGTTGGCCACCTCCATCCTAGG - Intergenic
1125214474 15:37254665-37254687 GAGGTGTGCACCACCTGCCTGGG + Intergenic
1125764380 15:42123492-42123514 GAGCTGGGAAACTCCAGCCCAGG + Intergenic
1126150203 15:45516872-45516894 GAGATGGTGCACTCCAGCCTGGG + Intronic
1126185022 15:45823428-45823450 GAGATGGGCTCCCACAGCCTTGG + Intergenic
1126190493 15:45873340-45873362 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1126207327 15:46060199-46060221 GTGGTGGCCTCCTCCAGCCTTGG - Intergenic
1126375477 15:47992613-47992635 GAGATGGGGTCATCCAGGCTGGG - Intergenic
1127165308 15:56239409-56239431 CAGGTGGGCACCACCACCCTCGG + Intronic
1127195674 15:56583202-56583224 CAGATGGGCACCACCATACTTGG - Intergenic
1129904735 15:79178492-79178514 AAGAAGGGCATCTCCAGCTTAGG - Intergenic
1130085602 15:80776676-80776698 GAATTGGGCATCTCCACCCTTGG - Intergenic
1130151170 15:81312905-81312927 GTGATGGGCACATAAAGCCTTGG + Exonic
1130409267 15:83631184-83631206 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1132004926 15:98218352-98218374 GAGACAGTCAACTCCAGCCTGGG - Intergenic
1132354423 15:101160600-101160622 GAGATGGGAACAGCCAGCCAGGG + Intergenic
1132830050 16:1923581-1923603 GGGGTGGGCAGCCCCAGCCTGGG + Intergenic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG + Intergenic
1132977226 16:2716805-2716827 GAGAAGGGGACATCTAGCCTGGG - Intronic
1134190998 16:12121197-12121219 CAGATGGGCACCTCTAGCCCAGG + Intronic
1134642122 16:15837675-15837697 CAGATGCGCACCACCACCCTTGG + Intronic
1134746852 16:16595165-16595187 CAGATGGGCACCCACAGCCAGGG - Intergenic
1134998622 16:18758498-18758520 CAGATGGGCACCCACAGCCAGGG + Intergenic
1135417675 16:22280981-22281003 GAGATGGCCCACTCCAGCCTGGG - Intronic
1136268302 16:29133444-29133466 GAATTGGCCAGCTCCAGCCTGGG - Intergenic
1136674725 16:31892781-31892803 GAGGTGGGCTCTTACAGCCTTGG + Intronic
1136714300 16:32264523-32264545 GACAAGATCACCTCCAGCCTGGG + Intergenic
1136753592 16:32664894-32664916 GAAAGGATCACCTCCAGCCTGGG - Intergenic
1136814521 16:33205471-33205493 GAAAGGATCACCTCCAGCCTGGG + Intronic
1136820997 16:33315551-33315573 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1136827560 16:33372090-33372112 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1136832626 16:33470861-33470883 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1137035243 16:35564537-35564559 GAGATGTGACCCTCCTGCCTGGG - Intergenic
1137623941 16:49895663-49895685 CAGATGGGCACCCCCACCATAGG + Intergenic
1137993763 16:53186216-53186238 GAGGTGGGCTCCCACAGCCTTGG - Intronic
1139570120 16:67806489-67806511 GAGCTGGGAACCCGCAGCCTGGG - Exonic
1139706041 16:68741281-68741303 CAGAAGGGCACTTCCATCCTGGG - Intronic
1139939723 16:70596513-70596535 AAGACAGTCACCTCCAGCCTGGG - Intronic
1141542729 16:84738583-84738605 GAGATGGGCTACACTAGCCTTGG - Intronic
1141634476 16:85306739-85306761 GAGCGGGCCACCTCCAGCCCTGG + Intergenic
1142071611 16:88093778-88093800 GAATTGGCCAGCTCCAGCCTGGG - Intronic
1142219454 16:88846557-88846579 GAGATTGTGCCCTCCAGCCTGGG - Intronic
1202993097 16_KI270728v1_random:28445-28467 GAAAGGATCACCTCCAGCCTGGG + Intergenic
1203055751 16_KI270728v1_random:925246-925268 GACAAGATCACCTCCAGCCTGGG - Intergenic
1144507636 17:15846286-15846308 GAGATGTGCACCACCACACTTGG - Intergenic
1144543780 17:16172977-16172999 GAGATGGGGCACTCCAGTCTGGG - Intronic
1145171758 17:20663905-20663927 GAGATGTGCACCACCACACTTGG - Intergenic
1145378113 17:22370629-22370651 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1145925567 17:28644630-28644652 GCGATGGGCACCTGCAGCATCGG - Intronic
1145942757 17:28751649-28751671 GAAATGGGGCCCTCCTGCCTAGG + Intergenic
1146098423 17:29954852-29954874 GAGGTGGGCTCCCACAGCCTTGG - Intronic
1146260075 17:31415245-31415267 GAGGTGGGCACCTCAGGCCCAGG + Intronic
1147122587 17:38344211-38344233 GAGATGGGCAAATCCAGGATGGG + Intergenic
1147387951 17:40092721-40092743 GAGGTGGCCCCCCCCAGCCTTGG + Intronic
1147667727 17:42159437-42159459 GAGGTGAGCCTCTCCAGCCTGGG + Intronic
1147882183 17:43661170-43661192 GAAATGGGGACCAGCAGCCTGGG - Exonic
1149339615 17:55672157-55672179 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1150371175 17:64639432-64639454 CAGATGTGCACCACCAGGCTTGG - Intronic
1150987468 17:70214220-70214242 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1151535852 17:74738391-74738413 GAAATGGGCCCCTGCACCCTCGG + Intronic
1151544394 17:74783680-74783702 GAGATTGCCAACTCCTGCCTTGG - Intronic
1151744010 17:76001809-76001831 AAGAAGGGCACTTCCAGCCAGGG - Intronic
1152067346 17:78119029-78119051 GAGAAGAGCACCCCCAGCCTGGG + Exonic
1154038698 18:10832922-10832944 AACGTGGGCTCCTCCAGCCTAGG - Intronic
1154231843 18:12563334-12563356 GAGATGGGGGTCTCCAGCCCAGG + Intronic
1156558276 18:38092094-38092116 GAGATGGGCTCCATTAGCCTGGG + Intergenic
1157669372 18:49515353-49515375 CAGATGGGCACCACCACGCTCGG + Intergenic
1158498918 18:57982852-57982874 GAGATGGCCCCATCCAGCCCAGG + Intergenic
1159536661 18:69723796-69723818 GAGATGGGCAGCCACAGACTTGG + Intronic
1159878106 18:73832788-73832810 GTGATGGGCACCTCCTGGCCAGG + Intergenic
1160065588 18:75571048-75571070 GAGATTGCCCACTCCAGCCTGGG + Intergenic
1160148080 18:76380054-76380076 GGGACGGGCACCTCCTGCTTGGG + Exonic
1160223828 18:76997315-76997337 GAGCTGGGAAGCTCCAGCCCGGG + Intronic
1161394335 19:4037327-4037349 GGGTGGGGCACCTCCAGCCCCGG + Intronic
1164674942 19:30094757-30094779 GAGAGAGGCCCCTCTAGCCTAGG + Intergenic
1165359878 19:35329671-35329693 GAGATGGGCGCCTCCAGAGCAGG - Intronic
1165548540 19:36562786-36562808 GAGATTGTGCCCTCCAGCCTGGG + Intronic
1166724294 19:45016608-45016630 GTTATGGGAAACTCCAGCCTGGG + Intronic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
1167508030 19:49881382-49881404 GGGCAGGGAACCTCCAGCCTGGG - Exonic
926327441 2:11797491-11797513 GAGGTGGGCTCCCACAGCCTTGG - Intronic
926392011 2:12403194-12403216 GAGGTGGGCTCCAACAGCCTTGG - Intergenic
926456469 2:13073761-13073783 GAGGTGGGCTCCTACAGCCTTGG + Intergenic
926611852 2:14955258-14955280 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
926809031 2:16740216-16740238 CAGCTGGGCACCTCCAGCGTGGG - Intergenic
926840224 2:17071540-17071562 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
927476697 2:23419365-23419387 CAGGTGGGACCCTCCAGCCTGGG - Intronic
928267581 2:29824518-29824540 GAGGTGGGCTCCCACAGCCTCGG - Intronic
928474939 2:31616454-31616476 GAGGTGGGCACCTATGGCCTTGG - Intergenic
928609983 2:32983127-32983149 GAGATGGGCTCCCACAGCCATGG - Intronic
928749959 2:34459419-34459441 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
930076207 2:47407615-47407637 GAGCTGGGCAACCACAGCCTTGG - Intronic
930427784 2:51233868-51233890 GAGGTGGGCTCCTACAGCCTTGG + Intergenic
931468288 2:62511827-62511849 GAGATGGGAACGTCAAGCCGAGG + Intronic
931612152 2:64113246-64113268 GAGCTGTGATCCTCCAGCCTGGG + Intronic
931949774 2:67349786-67349808 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
932417148 2:71580322-71580344 GAGACAGGCAGCTCAAGCCTGGG + Intronic
933070958 2:77857459-77857481 GAGATGGGCTCCCAGAGCCTTGG - Intergenic
934028303 2:88018776-88018798 GGGCAGGGCACCTCCTGCCTGGG - Intergenic
935425731 2:102916828-102916850 GAGATGGGCTCCTAAGGCCTTGG + Intergenic
937274348 2:120674478-120674500 GAGATGGGCACCACCTGCACAGG + Intergenic
939285493 2:140123783-140123805 GAAATGGGAGCCTCCTGCCTGGG + Intergenic
939361300 2:141175875-141175897 GGGGTGGGCTCCTACAGCCTTGG - Intronic
939860110 2:147409872-147409894 GAAATGGTCGCCTCCAGTCTAGG - Intergenic
940484160 2:154275876-154275898 GAGATGGGCTCCCACGGCCTTGG - Intronic
940526122 2:154816475-154816497 GAAATGAGCTCCTCCAGCTTTGG - Intronic
940621791 2:156122050-156122072 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
944011395 2:194979220-194979242 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
945166592 2:206953499-206953521 GAGGTGGGCTCCTACAACCTTGG + Intronic
947417811 2:229916411-229916433 CAGACGGGCACCTCCACACTTGG - Intronic
948009195 2:234637052-234637074 GAGGTGGGCTCCTGCAGCCTTGG - Intergenic
1168748374 20:264105-264127 CAGCTCGGCACCTACAGCCTGGG + Intergenic
1168858852 20:1030284-1030306 GAGATGGGCTCTGCCAGCCTGGG - Intergenic
1170930835 20:20768395-20768417 GAGGGAGCCACCTCCAGCCTTGG - Intergenic
1171571542 20:26255914-26255936 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1172384079 20:34521059-34521081 GAGATCGTGCCCTCCAGCCTGGG - Intronic
1172456591 20:35079877-35079899 GAGGTGTGCACCACCACCCTTGG - Intronic
1173712974 20:45176488-45176510 GAGAGAGGCAGCTCCAGCCGTGG - Exonic
1174297989 20:49562435-49562457 GATGTTGGCTCCTCCAGCCTTGG + Intronic
1175121320 20:56718279-56718301 CAGATGGGCACCTCCAGGGAAGG - Intergenic
1175681938 20:60995459-60995481 GAGATGGCCACCCAGAGCCTCGG + Intergenic
1175731999 20:61360517-61360539 GAGATGAGACCCTCCCGCCTAGG + Intronic
1177604424 21:23359842-23359864 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1177912143 21:27046111-27046133 GAGATGGCCACCTGCAAGCTAGG - Intergenic
1178738233 21:35171913-35171935 GTGATGGGCTGCTGCAGCCTGGG + Intronic
1179044032 21:37829400-37829422 GAGCTGGGGGCCTCCAGCTTTGG + Intronic
1180004836 21:45015536-45015558 GTGAGGGGCTCCTCAAGCCTTGG - Intergenic
1181270271 22:21654436-21654458 GGGGTGGCCACCTCCAGCCATGG - Intronic
1182512013 22:30826515-30826537 GGAGGGGGCACCTCCAGCCTTGG - Intronic
1182815245 22:33156377-33156399 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1183117966 22:35706445-35706467 GACATGAGCATCTCCAGCCCAGG + Intergenic
1183312904 22:37120984-37121006 GAGCTGGACACCTGCAGGCTTGG - Intergenic
1183627791 22:39015248-39015270 GAGATTGCAAACTCCAGCCTGGG + Intronic
1184449625 22:44575299-44575321 GGGCTGGGCACCTCCCACCTAGG + Intergenic
1185310997 22:50154149-50154171 GAGCTGGACACCTCCAGACATGG + Intronic
949502441 3:4693751-4693773 GAGAAGGGCACAGCCAGGCTGGG - Intronic
950452757 3:13074375-13074397 GAGAAGCGCACATCCATCCTCGG + Intergenic
950788750 3:15455945-15455967 GGGATGGGCTCCTGCAGCCTGGG - Exonic
950806046 3:15603903-15603925 GAGGTGGGCTCCCACAGCCTTGG + Intronic
950853101 3:16081578-16081600 GAGGTGTGCTCCTACAGCCTTGG + Intergenic
951969731 3:28430216-28430238 GAGGTGGGCTCCCACAGCCTTGG - Intronic
952283655 3:31947330-31947352 GGAATTGGCACCTCCAGCTTTGG - Intronic
952401274 3:32966265-32966287 GAGATGGGCTCCTACAGCCTTGG - Intergenic
952584694 3:34877238-34877260 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
953456601 3:43047273-43047295 GAGATGGGCTCCCACAGTCTTGG - Intronic
953784006 3:45896891-45896913 GAGAGGGGCATCTTGAGCCTGGG + Intronic
953960612 3:47263250-47263272 CAGCTGAGCACCTCCAGCTTGGG - Intronic
954442946 3:50531612-50531634 GGGATGGGCAGCACCAGCCTTGG - Intergenic
954680395 3:52342927-52342949 CAGGTGAGCTCCTCCAGCCTCGG - Intronic
954870721 3:53765620-53765642 TAGATTGTCATCTCCAGCCTGGG + Intronic
956391695 3:68779986-68780008 GAGGTGGGCTCCCACAGCCTTGG - Intronic
958128435 3:89386784-89386806 GAGATGGGCTCCCACAGCCTTGG - Intronic
958463315 3:94426681-94426703 GAGATGGGCTCCCACAGCCTTGG - Intergenic
958583128 3:96052191-96052213 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
959507460 3:107171688-107171710 GGGATGGGCTCCCACAGCCTTGG - Intergenic
959606355 3:108245417-108245439 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
959754662 3:109883430-109883452 GAGATGGGCTCCCACAGCCTTGG + Intergenic
960494198 3:118355278-118355300 GAGGTGGGCACCCAAAGCCTTGG - Intergenic
960937728 3:122913544-122913566 GAGAACGGCAACTCCTGCCTGGG - Exonic
961514286 3:127423067-127423089 AAGGTGGGCACCTCCAGCCCCGG - Intergenic
962067051 3:131992294-131992316 GAGGTGGGCTCCCACAGCCTTGG - Intronic
962421531 3:135233424-135233446 GAGGTGGGCTCCCACAGCCTTGG + Intronic
962891362 3:139676004-139676026 GAGAAGGGAAGCTCCAGGCTTGG - Intronic
963386160 3:144597945-144597967 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
963671673 3:148258845-148258867 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
963671832 3:148260397-148260419 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
963878265 3:150500884-150500906 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
964895472 3:161590444-161590466 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
964966117 3:162495793-162495815 GAGATGGGCTCCCACAGCCTTGG + Intergenic
965083468 3:164065017-164065039 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
968622650 4:1610728-1610750 GGGAGGTGCCCCTCCAGCCTTGG - Intergenic
968736607 4:2300533-2300555 GAGAGGGGCTCCTCCTGGCTGGG + Intronic
969144422 4:5108962-5108984 GCCTTGTGCACCTCCAGCCTTGG - Intronic
969482066 4:7451961-7451983 GTGAAGGGCACTTCCTGCCTTGG - Intronic
970265987 4:14286914-14286936 GAGATGGGCACCTTCTTCCTTGG - Intergenic
970818997 4:20191080-20191102 GAGGTGGGCTCCTAAAGCCTTGG - Intergenic
971912288 4:32809977-32809999 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
974319974 4:60334400-60334422 GAGGTGGGCTCCTACAACCTTGG - Intergenic
974748214 4:66103196-66103218 GAGGTGGGCTCCTACAGCTTTGG - Intergenic
974779199 4:66529241-66529263 GAGATGGGCTCCCACAGCCTTGG - Intergenic
974811921 4:66956532-66956554 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
974843465 4:67323743-67323765 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
976312225 4:83623465-83623487 GAGATGGGTTCCCACAGCCTTGG - Intergenic
977702446 4:100035834-100035856 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
978213107 4:106162261-106162283 GAGATGGGCACCCATGGCCTTGG + Intronic
979411533 4:120384981-120385003 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
980031556 4:127837844-127837866 GAGATTGTGCCCTCCAGCCTGGG - Exonic
980560063 4:134460713-134460735 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
981242453 4:142493481-142493503 GAGATGGGCTCCCACAGCCTTGG - Intronic
981748638 4:148073283-148073305 ATGATGGCCACCCCCAGCCTGGG + Intergenic
982000746 4:151018956-151018978 GAGATTGGCCACTCCAGCCTGGG + Intergenic
982189012 4:152834631-152834653 GGGATGGGCACCTCAGGCTTTGG + Intronic
982716872 4:158817914-158817936 GGGATGGCTGCCTCCAGCCTAGG + Intronic
983417749 4:167480149-167480171 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
983657426 4:170097806-170097828 CAGATGGGCTCCCACAGCCTTGG + Intergenic
983817641 4:172152117-172152139 CAGTTGGGCACCACCAGCCCTGG + Intronic
983874822 4:172863411-172863433 GAGATGGGCTCCTACAGCCTTGG - Intronic
984028501 4:174573892-174573914 GAGATGGTAAAATCCAGCCTTGG + Intergenic
985516836 5:350653-350675 CAGGTGGGCCCCTCCAGCCAGGG + Intronic
985818104 5:2141727-2141749 GAGCTGGGGCCGTCCAGCCTGGG - Intergenic
985886330 5:2682681-2682703 GAGGTGGGCACCCACATCCTAGG - Intergenic
987984959 5:25134388-25134410 AAGTTGGGCTCCTACAGCCTTGG - Intergenic
988319186 5:29670260-29670282 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
988396056 5:30698981-30699003 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
992375607 5:76185182-76185204 GAGGTGGGCTCCCACAGCCTTGG + Intronic
993293875 5:86109463-86109485 GAGGTGGGCCCCCACAGCCTTGG - Intergenic
993777057 5:92012556-92012578 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
993985699 5:94594953-94594975 GAGGTGGGCTCCCACAGCCTTGG + Intronic
994019038 5:95002472-95002494 GAGGTGGGCTCCCACAGCCTTGG - Intronic
994689472 5:102999311-102999333 GAGGTGGGCTCCCACAGCCTTGG + Intronic
995120606 5:108532191-108532213 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
995178133 5:109202357-109202379 GAGTTGGAGACCACCAGCCTAGG + Intergenic
995391041 5:111640372-111640394 GAGGTGGGCTCCTACAGCCTTGG - Intergenic
995630467 5:114127011-114127033 GAGATGGGCTCCCATAGCCTTGG + Intergenic
996179355 5:120399961-120399983 GAGGTGGGCTCCTACAGCCTTGG - Intergenic
999251474 5:150184908-150184930 GAGAAGGGCATCTCCAGGGTAGG + Intergenic
1000062343 5:157668693-157668715 GTGATGGGGACCTGCAGACTGGG + Intronic
1000705344 5:164503711-164503733 GAGATTGGGCACTCCAGCCTGGG + Intergenic
1000777809 5:165441845-165441867 GAGGTGGACTCCTGCAGCCTTGG + Intergenic
1001023442 5:168203766-168203788 GAGCTGGACCCCTCCAACCTCGG + Exonic
1001473328 5:172031529-172031551 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1002080256 5:176733385-176733407 GAGAGGGGCTCCTCCGGCCTGGG - Intergenic
1002101172 5:176858394-176858416 GAGGTGGGAAGCTCCTGCCTCGG + Intronic
1003366343 6:5478528-5478550 CAGATGGGGAGCTCCAGCCAGGG - Intronic
1003545258 6:7052694-7052716 GAGGCGGCCAGCTCCAGCCTTGG + Intergenic
1005743711 6:28816416-28816438 GTGTTGGGCACTTCCTGCCTTGG - Intergenic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1005983056 6:30852093-30852115 GAGATGGGCTCCCACAGCATTGG - Intergenic
1006367584 6:33624627-33624649 GACATGGGCACCAACAGCCTCGG - Intronic
1006595837 6:35192138-35192160 GCCATGGGAACCCCCAGCCTGGG - Intergenic
1007176726 6:39902306-39902328 GAGCAGGGCCCCTTCAGCCTGGG - Exonic
1008688948 6:53956318-53956340 GCGGTGGGCAGCTGCAGCCTGGG + Intronic
1009550826 6:65089342-65089364 GAGGTGGGCTCCCACAGCCTTGG - Intronic
1009726616 6:67543340-67543362 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1010330986 6:74623765-74623787 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1010525294 6:76894017-76894039 GAGGTGGGCACCCACAGCTTTGG + Intergenic
1010892386 6:81329736-81329758 GAGATGGTCATCTCCTGCCAGGG + Intergenic
1011347753 6:86390188-86390210 GAGATGGGCTCCCAGAGCCTTGG - Intergenic
1011870521 6:91886626-91886648 GAGATGGGCTCCCACAGCTTTGG - Intergenic
1011876335 6:91966371-91966393 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1012068167 6:94576998-94577020 GAGGTGGGCTCCTTCAGCCTTGG + Intergenic
1012076250 6:94690756-94690778 GAGGTGGGCTCATACAGCCTTGG + Intergenic
1012478144 6:99637270-99637292 GAGTTGGGCTCCCACAGCCTTGG + Intergenic
1012762333 6:103317849-103317871 GAGGTGGGATCCTACAGCCTTGG - Intergenic
1013012263 6:106131586-106131608 TAGTTGTGCACCACCAGCCTTGG - Intergenic
1013688148 6:112609644-112609666 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1014126899 6:117786660-117786682 GAGGTAGGCACCTCCAGGCTGGG - Intergenic
1014470050 6:121802196-121802218 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1014714623 6:124849484-124849506 AAGGTGGGCACCCACAGCCTTGG - Intergenic
1014721208 6:124920464-124920486 GAGTTGGGCACCCACAGCTTTGG + Intergenic
1014883006 6:126746241-126746263 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1014883890 6:126756420-126756442 TAGGTGGGCTCCTACAGCCTTGG + Intergenic
1014895270 6:126893158-126893180 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1015045127 6:128767853-128767875 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1015903973 6:138097237-138097259 TACATGGGTACCTCCAGCCCTGG + Intronic
1016592932 6:145766231-145766253 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1016682279 6:146844927-146844949 GAGATGGGCTCCCACAGCCTTGG + Intergenic
1017342106 6:153336035-153336057 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1017957012 6:159187103-159187125 GTAATGGGGACCTGCAGCCTAGG + Intronic
1018034386 6:159869006-159869028 GAGATTGTGCCCTCCAGCCTGGG - Intergenic
1018093655 6:160366389-160366411 GAGATGGGCTCCCACAGCCTTGG + Intronic
1018922640 6:168186142-168186164 GAGGTGGGCTCCCACAGCCTCGG + Intergenic
1019064431 6:169284848-169284870 GAGCTGGAGCCCTCCAGCCTGGG + Intergenic
1019199243 6:170300840-170300862 GAGGTGGGCTCCCACAGCCTTGG + Intronic
1020254823 7:6497286-6497308 GGGATGTGCACGCCCAGCCTGGG - Intergenic
1020869367 7:13608006-13608028 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1021106308 7:16643950-16643972 GAGAGCTGCAACTCCAGCCTGGG + Intronic
1021607227 7:22420309-22420331 CAGATGGTGTCCTCCAGCCTGGG + Intronic
1021880038 7:25085869-25085891 GAGATGGTGCACTCCAGCCTGGG + Intergenic
1022554262 7:31276133-31276155 AAGATGGCCCACTCCAGCCTGGG + Intergenic
1022862578 7:34383238-34383260 GAGATGGGTTCCTACAGCCTTGG - Intergenic
1023487190 7:40699724-40699746 CAGATGTGCACCACCAGGCTCGG - Intronic
1024207623 7:47177314-47177336 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1024861845 7:53853425-53853447 GAGAGGGGCAACCCCAACCTTGG - Intergenic
1024990679 7:55232561-55232583 GAGATCCGCCACTCCAGCCTGGG - Intronic
1025285840 7:57659962-57659984 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1025861870 7:65337936-65337958 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG + Intronic
1026942999 7:74298770-74298792 GTGATTGTCACCGCCAGCCTCGG + Intronic
1027214193 7:76173580-76173602 GAGATGGGGAGCACCATCCTGGG + Intergenic
1028048454 7:86152635-86152657 GAGGTGGGCTCCAACAGCCTTGG - Intergenic
1028136612 7:87229903-87229925 GTGATGCGCACCTAAAGCCTTGG + Intergenic
1029462158 7:100701528-100701550 AAAATGGGCAAATCCAGCCTGGG - Intergenic
1030071506 7:105702001-105702023 GCTATGGGCCTCTCCAGCCTTGG + Intronic
1031396863 7:121284731-121284753 GAGGTGGTCTCCCCCAGCCTTGG + Intronic
1032247934 7:130229300-130229322 GAGAATGGCACCACCAGGCTTGG - Intergenic
1032487121 7:132296329-132296351 CAGATGGGCACCTCCAGGGAAGG + Intronic
1034460264 7:151194152-151194174 GAGGTGGACATGTCCAGCCTGGG - Intronic
1035149845 7:156860868-156860890 AAGGTGGGCTCCTACAGCCTTGG + Intronic
1035277197 7:157754635-157754657 GAGAAGGGCCCCCCCAGACTGGG - Intronic
1035549409 8:509073-509095 GAGATGGGCTCCTACCACCTTGG + Intronic
1035643152 8:1198808-1198830 GGGATGGGCACCTCCCTCCTGGG + Intergenic
1037952555 8:23028471-23028493 GAGACGGTGACCTCCAGCCCAGG - Exonic
1038052719 8:23828505-23828527 GAGAAGGGCACCTGCTGCCTGGG - Intergenic
1038415586 8:27392826-27392848 GACATGGGCACCACCTTCCTGGG + Intronic
1039071433 8:33652458-33652480 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1040797250 8:51299809-51299831 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1041901521 8:62988120-62988142 GAGGTGGGCTCCCACAGCCTTGG + Intronic
1042646017 8:70987537-70987559 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1042735086 8:71978938-71978960 GAGAGTGGCACCTCCATTCTAGG - Intronic
1043704335 8:83330044-83330066 GAGGTGGTCTCCTGCAGCCTTGG + Intergenic
1044205842 8:89491121-89491143 GAGGTGGGCTTCTACAGCCTTGG - Intergenic
1045139894 8:99268444-99268466 GAGATGGGCTCCCACAGCCTTGG - Intronic
1046628212 8:116597852-116597874 CAGATGGGCAGTTCCAGCTTTGG + Intergenic
1049187950 8:141268814-141268836 GAGATGGGCGCCTCCACGATAGG - Intronic
1049569873 8:143364372-143364394 GACATGAGCACCCACAGCCTGGG + Intergenic
1050079862 9:1904669-1904691 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1053201266 9:36153077-36153099 GAGATCGCCCACTCCAGCCTGGG + Intronic
1053469190 9:38333630-38333652 GAGAAGGGCACTTTCAGCCGAGG - Intergenic
1053600204 9:39602526-39602548 GGGCAGGGCACCTCCTGCCTGGG + Intergenic
1053793496 9:41703885-41703907 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1053857858 9:42356382-42356404 GGGCAGGGCACCTCCTGCCTGGG + Intergenic
1054253322 9:62739858-62739880 GGGCAGGGCACCTCCTGCCTGGG - Intergenic
1054471448 9:65542084-65542106 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1054567439 9:66774357-66774379 GGGCAGGGCACCTCCTGCCTGGG - Intergenic
1055277435 9:74635031-74635053 CAGATGGTCACCTTCAACCTAGG - Intronic
1055416650 9:76091256-76091278 CAGATGGGCACCTTCTGGCTGGG + Intronic
1056264480 9:84882810-84882832 GAGATCGCGAACTCCAGCCTGGG - Intronic
1057585906 9:96328534-96328556 TACTTGGGCACCTCCACCCTGGG - Intronic
1060276989 9:122189953-122189975 GAGATGTCCATCTCCAGCATGGG + Intronic
1060402860 9:123358246-123358268 GAGCTGGGCCTCTCCATCCTGGG + Intronic
1061118709 9:128630102-128630124 GAGATGGGAAGCTGCTGCCTTGG - Intronic
1061533720 9:131234753-131234775 GAGATGGGGACCTTCAGACCAGG - Intergenic
1061669679 9:132181839-132181861 GAGGCTGGCACCTCCAGCCTGGG + Intronic
1061824122 9:133247263-133247285 CAGAGGGGCACATCCAGCCTGGG + Intergenic
1062093168 9:134689185-134689207 GCCAGGGGCACCTGCAGCCTCGG - Intronic
1062126829 9:134868509-134868531 GGGATGCGCTCCTCCAGCCAGGG - Intergenic
1186218327 X:7323844-7323866 GAGAAGGGCACCCCAAGCCCAGG - Intronic
1187097149 X:16161286-16161308 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1187155078 X:16714298-16714320 GAGATGGGCATCACTGGCCTTGG + Intergenic
1187574824 X:20542820-20542842 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1187745454 X:22404131-22404153 GAGATCGCCCACTCCAGCCTGGG + Intergenic
1188006672 X:25020658-25020680 GAGATGGGGAACTCCCGCCAAGG - Intergenic
1188719550 X:33505949-33505971 GAGATGGGCTCCCACAGCCTCGG - Intergenic
1188769111 X:34131118-34131140 GAGATGGGACACTCCAGTCTTGG + Exonic
1188834859 X:34943586-34943608 GAGATGGGACACTCCAGTCTCGG - Exonic
1188834906 X:34943802-34943824 GAGATGGGACACTCCAGCCTCGG - Exonic
1189007258 X:37009198-37009220 GAGATGGGACACTCCAGTCTCGG - Exonic
1189007306 X:37009450-37009472 GAGATGGGACACTCCAGTCTCGG - Exonic
1189007321 X:37009522-37009544 GAGATGGGACACTCCAGCCTCGG - Exonic
1189007473 X:37010206-37010228 GAGATGGGACACTCCAGTCTCGG - Exonic
1189007525 X:37010422-37010444 GAGATGGGACACTCCAGTCTCGG - Exonic
1189040957 X:37542177-37542199 GAGATGGGACACTCCAGTCTCGG + Intronic
1189041260 X:37543599-37543621 GAGATGGGACACTCCAGTCTCGG + Intronic
1190779567 X:53580276-53580298 GAGATAATCACCACCAGCCTTGG - Intronic
1193043075 X:77024307-77024329 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1193183225 X:78483143-78483165 GAGGTAGGCTCCTACAGCCTTGG + Intergenic
1193199029 X:78666091-78666113 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1193210565 X:78802228-78802250 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1193467262 X:81865342-81865364 GAGGTAGGCTCCTACAGCCTTGG + Intergenic
1194397474 X:93403763-93403785 GAGGTGGGCTCCTGCAGCCTTGG + Intergenic
1194525319 X:94970021-94970043 GTGATGGGCTCCCACAGCCTTGG - Intergenic
1194756369 X:97743705-97743727 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1194929473 X:99868281-99868303 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1195126681 X:101815168-101815190 GAGGTGGGCTCCCACAGCCTTGG + Intergenic
1195517559 X:105794745-105794767 GAGGGGAGCACCTCCAGTCTAGG + Intergenic
1196011919 X:110898006-110898028 GAGGTGGGCTCCTACAGCCTTGG + Intergenic
1196063288 X:111434182-111434204 GATATGGTCACCTCTATCCTTGG + Intergenic
1196459145 X:115911968-115911990 GACAGGGGCTCCTACAGCCTGGG + Intergenic
1197088616 X:122509951-122509973 GAGGTGGGCTCCAACAGCCTTGG + Intergenic
1197089557 X:122520874-122520896 GAGATGGACTCCCACAGCCTTGG + Intergenic
1197441342 X:126494718-126494740 GAGATGGGTTCCCACAGCCTTGG - Intergenic
1197466270 X:126807493-126807515 GAGATAGGCTCCCACAGCCTTGG - Intergenic
1197536226 X:127691708-127691730 GAGGTGGGCTCCCACAGCCTTGG - Intergenic
1197977420 X:132180700-132180722 CAGATCTGCATCTCCAGCCTCGG + Intergenic
1198031643 X:132758967-132758989 GAGCTGGGCCCCTCCAACCTGGG + Intronic
1198612574 X:138418270-138418292 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1198660875 X:138966373-138966395 GAGGTGGGCTCCTACATCCTTGG - Intronic
1199043272 X:143139463-143139485 GAGGTGGGCTCCTACAGCCTTGG - Intergenic
1199070352 X:143468783-143468805 GAGGTGGGCTCCGACAGCCTTGG + Intergenic
1199909711 X:152272267-152272289 GAGGTGGGCTCCCACAGCCTTGG - Intronic
1199931774 X:152530613-152530635 GGGGTGGGCTCCTACAGCCTTGG + Intergenic
1200380785 X:155834949-155834971 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1200480534 Y:3697252-3697274 GAGATTGGTACCACCACCCTTGG - Intergenic
1201920219 Y:19226013-19226035 GCCATGGTCACATCCAGCCTGGG - Intergenic