ID: 1026451077

View in Genome Browser
Species Human (GRCh38)
Location 7:70530173-70530195
Sequence GCACAACGCAAAACTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026451077_1026451080 5 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451080 7:70530201-70530223 GCAAATGCATATCCGTGCTGGGG No data
1026451077_1026451081 15 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451081 7:70530211-70530233 ATCCGTGCTGGGGAGTGTTATGG No data
1026451077_1026451079 4 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451079 7:70530200-70530222 TGCAAATGCATATCCGTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 66
1026451077_1026451078 3 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451078 7:70530199-70530221 GTGCAAATGCATATCCGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1026451077_1026451082 16 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451082 7:70530212-70530234 TCCGTGCTGGGGAGTGTTATGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1026451077_1026451084 25 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451084 7:70530221-70530243 GGGAGTGTTATGGGTTTATGAGG 0: 1
1: 0
2: 0
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026451077 Original CRISPR GCACAACGCAAAACTCCCCT TGG (reversed) Intronic