ID: 1026451079

View in Genome Browser
Species Human (GRCh38)
Location 7:70530200-70530222
Sequence TGCAAATGCATATCCGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026451077_1026451079 4 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451079 7:70530200-70530222 TGCAAATGCATATCCGTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026451079 Original CRISPR TGCAAATGCATATCCGTGCT GGG Intronic