ID: 1026451080

View in Genome Browser
Species Human (GRCh38)
Location 7:70530201-70530223
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026451077_1026451080 5 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1026451080 7:70530201-70530223 GCAAATGCATATCCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr