ID: 1026451081

View in Genome Browser
Species Human (GRCh38)
Location 7:70530211-70530233
Sequence ATCCGTGCTGGGGAGTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026451077_1026451081 15 Left 1026451077 7:70530173-70530195 CCAAGGGGAGTTTTGCGTTGTGC No data
Right 1026451081 7:70530211-70530233 ATCCGTGCTGGGGAGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026451081 Original CRISPR ATCCGTGCTGGGGAGTGTTA TGG Intronic