ID: 1026451084 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:70530221-70530243 |
| Sequence | GGGAGTGTTATGGGTTTATG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 139 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 130} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1026451077_1026451084 | 25 | Left | 1026451077 | 7:70530173-70530195 | CCAAGGGGAGTTTTGCGTTGTGC | No data | ||
| Right | 1026451084 | 7:70530221-70530243 | GGGAGTGTTATGGGTTTATGAGG | 0: 1 1: 0 2: 0 3: 8 4: 130 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1026451084 | Original CRISPR | GGGAGTGTTATGGGTTTATG AGG | Intronic | ||