ID: 1026451633

View in Genome Browser
Species Human (GRCh38)
Location 7:70534366-70534388
Sequence CAGAATATCGGGGAGTTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026451627_1026451633 28 Left 1026451627 7:70534315-70534337 CCAATGAGATTTTTACATTTGAG 0: 1
1: 0
2: 2
3: 33
4: 297
Right 1026451633 7:70534366-70534388 CAGAATATCGGGGAGTTATTGGG 0: 1
1: 0
2: 1
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026451633 Original CRISPR CAGAATATCGGGGAGTTATT GGG Intronic
900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG + Intergenic
900848039 1:5119394-5119416 CAGAATAGCTGGGAGATAATGGG + Intergenic
902883256 1:19386786-19386808 CAGAATTTCTGTGAGTTATGAGG - Intronic
911147156 1:94563368-94563390 TGGAATATCTGGGAGATATTGGG - Intergenic
914416515 1:147488310-147488332 CAGAATATATGGCAGTTAGTAGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919690476 1:200524280-200524302 CAGAATATCAGGGAGCAGTTAGG - Intergenic
920715905 1:208339852-208339874 CAGAATGTCTGGGATATATTAGG - Intergenic
1068868809 10:61922041-61922063 CTGAAGAGCGGGGAGATATTTGG - Intronic
1079614318 11:22471788-22471810 CAGAGTTTCGGGGAGTTAAAAGG - Intergenic
1085854322 11:80158775-80158797 CATAATCTGGGGGAGTTATTTGG - Intergenic
1087602752 11:100337618-100337640 CAGAATAACGGGAACTAATTGGG + Intronic
1088567713 11:111190532-111190554 CAGCATATCCAGGAGTTATGGGG - Intergenic
1090222299 11:125038342-125038364 GGGAATTTCTGGGAGTTATTTGG + Intronic
1106027715 13:25971199-25971221 CAGAAAATCTGTGAGTAATTAGG - Intronic
1109588348 13:64440962-64440984 GAGAATATTAGGGAGTGATTAGG - Intergenic
1111674690 13:91372877-91372899 CAGAACATAGAGGAGTTTTTGGG - Intergenic
1112240911 13:97680173-97680195 CATGATATAGGGGGGTTATTGGG - Intergenic
1114385982 14:22255255-22255277 CAGAATGTTGGGTATTTATTTGG + Intergenic
1115439285 14:33413412-33413434 CAGAATCTCTGGGAGTATTTAGG + Intronic
1115676791 14:35685080-35685102 TAGAATATCAGGGAGGTCTTTGG + Exonic
1125937226 15:43647916-43647938 CACACTATCAGGGAGTTACTTGG - Exonic
1127919465 15:63481920-63481942 CAGCATATCTGTGAGTTATAAGG + Intergenic
1136108058 16:28045079-28045101 CAGAGCATCGGGGATTTTTTGGG + Intronic
1138081038 16:54091715-54091737 CATATTATAGGGGAGTGATTTGG + Intronic
1139566354 16:67779608-67779630 CTGAATATGGCTGAGTTATTAGG + Intronic
1144242869 17:13331268-13331290 CAGCATATGGGGGGGATATTCGG - Intergenic
1149324256 17:55513670-55513692 CAATATTTAGGGGAGTTATTTGG + Intergenic
1151276720 17:73040077-73040099 CAGAATATCGGGGAATGCTATGG - Intronic
1166264386 19:41669189-41669211 AAGAGTATCGGTGAGTTATTTGG - Intronic
1168416469 19:56172239-56172261 CAGAGTATCTGGGAATTCTTTGG + Intergenic
939486641 2:142821017-142821039 CAAAATTTGAGGGAGTTATTTGG + Intergenic
942468802 2:176238317-176238339 AACAATATCAGGGAATTATTAGG - Intergenic
943475408 2:188348295-188348317 CGGAATATCAGGAAGTTATCTGG + Intronic
946138580 2:217668634-217668656 GAGAATATCGGGATGTTACTGGG + Intronic
948329712 2:237155378-237155400 CAGAAGAGCGGGGAGGTATGAGG + Intergenic
1169046528 20:2537987-2538009 CAGAATCTTGGGGAGTGATGGGG + Intronic
1169218525 20:3807213-3807235 CACAATAGGTGGGAGTTATTGGG + Intergenic
950216849 3:11166347-11166369 GAGAATAGAGGAGAGTTATTTGG - Intronic
954991884 3:54848424-54848446 CAGAATATGGGGCATTTGTTTGG - Intronic
958004704 3:87796043-87796065 CAGAATAGCAAGAAGTTATTGGG - Intergenic
960084519 3:113576374-113576396 CAGGCAATCGGGGAGCTATTAGG + Intronic
961679477 3:128589518-128589540 CAGAATATGGGGGAGTTTTTAGG - Intergenic
966699309 3:182828479-182828501 CAGAATATCTGAAAGATATTAGG - Intronic
970029670 4:11660560-11660582 CAGAATATCTGGGAGTTGTGTGG - Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
974519213 4:62959362-62959384 CAGGATATTGGGGAGGTACTTGG + Intergenic
976421428 4:84849059-84849081 AAGGATACAGGGGAGTTATTAGG - Intronic
976704864 4:88008925-88008947 AATAATATCGTGAAGTTATTTGG + Intronic
981375927 4:144015793-144015815 CTGAATTTTGGGGATTTATTGGG + Intronic
982622084 4:157721167-157721189 AAGAAAATAGGGGATTTATTTGG - Intergenic
983848734 4:172552887-172552909 AAGAACATCTGAGAGTTATTAGG - Intronic
985244628 4:187967849-187967871 CAGAAAATGGGGGAGTGTTTGGG - Intergenic
986669285 5:10128387-10128409 CAGAATCTCAGGCAGTTATGGGG + Intergenic
992733719 5:79698008-79698030 CAGCATATAAGGAAGTTATTTGG - Intronic
996597741 5:125225336-125225358 AAGCATATCAGGGAGTTATTAGG - Intergenic
1003547434 6:7071823-7071845 CAGAATCTTTTGGAGTTATTAGG + Intergenic
1010166007 6:72916310-72916332 CACAATATCTGGTAGTTACTGGG - Intronic
1013265832 6:108497942-108497964 CAGGCTATGGGGGAGTTCTTTGG + Intronic
1014037568 6:116785104-116785126 CAGAATTTCTGGCAGTTAGTAGG - Intergenic
1016917437 6:149257759-149257781 CAGATTTTAGGGGAGTTATCAGG - Intronic
1021799626 7:24291365-24291387 CAAAAGATCGGGGTGTTCTTCGG + Intronic
1026451633 7:70534366-70534388 CAGAATATCGGGGAGTTATTGGG + Intronic
1028800388 7:94957482-94957504 CAGAATTTTAGGGAGTTATCAGG + Intronic
1034751696 7:153574987-153575009 CACAATATGTGGGAGTTATGAGG - Intergenic
1039187620 8:34934703-34934725 CAGAATTTCGGGGAGATTTGGGG - Intergenic
1046764025 8:118050276-118050298 CTGAATATCTGTGAGGTATTTGG + Intronic
1047770147 8:128024360-128024382 CAGCATTTCGGGGAGCAATTTGG + Intergenic
1050052813 9:1621111-1621133 CAGAGTATCTGGGACTTAGTAGG - Intergenic
1051470111 9:17429597-17429619 CAGAATATCCATGAGTTAATTGG + Intronic
1053037521 9:34838045-34838067 CACAATATGGGGGATTTTTTTGG - Intergenic
1058493037 9:105522856-105522878 TAGAATATCAGGGAGGTCTTTGG - Intronic
1059365313 9:113782214-113782236 CAGAATCTAGGGGACTTATGGGG + Intergenic
1189453116 X:41158112-41158134 CAGAATCTCAGGGAAATATTGGG + Intronic
1195465643 X:105176299-105176321 CAGCATACTGGGTAGTTATTAGG + Intronic
1197570531 X:128145829-128145851 CAGAATAACAGGGTTTTATTAGG + Intergenic
1197674606 X:129315739-129315761 CAGCATATCTGGGAGTATTTGGG + Intergenic