ID: 1026455809

View in Genome Browser
Species Human (GRCh38)
Location 7:70571694-70571716
Sequence TCCCCAAGGCTCCTCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026455809_1026455815 11 Left 1026455809 7:70571694-70571716 CCTCTGTGGAGGAGCCTTGGGGA 0: 1
1: 0
2: 5
3: 41
4: 286
Right 1026455815 7:70571728-70571750 AGCTGCCATGAGGTGTGCAAGGG 0: 1
1: 0
2: 2
3: 7
4: 173
1026455809_1026455816 12 Left 1026455809 7:70571694-70571716 CCTCTGTGGAGGAGCCTTGGGGA 0: 1
1: 0
2: 5
3: 41
4: 286
Right 1026455816 7:70571729-70571751 GCTGCCATGAGGTGTGCAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 165
1026455809_1026455819 30 Left 1026455809 7:70571694-70571716 CCTCTGTGGAGGAGCCTTGGGGA 0: 1
1: 0
2: 5
3: 41
4: 286
Right 1026455819 7:70571747-70571769 AGGGGAGGACGTGTCAGCCCTGG No data
1026455809_1026455817 15 Left 1026455809 7:70571694-70571716 CCTCTGTGGAGGAGCCTTGGGGA 0: 1
1: 0
2: 5
3: 41
4: 286
Right 1026455817 7:70571732-70571754 GCCATGAGGTGTGCAAGGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 230
1026455809_1026455814 10 Left 1026455809 7:70571694-70571716 CCTCTGTGGAGGAGCCTTGGGGA 0: 1
1: 0
2: 5
3: 41
4: 286
Right 1026455814 7:70571727-70571749 CAGCTGCCATGAGGTGTGCAAGG No data
1026455809_1026455811 1 Left 1026455809 7:70571694-70571716 CCTCTGTGGAGGAGCCTTGGGGA 0: 1
1: 0
2: 5
3: 41
4: 286
Right 1026455811 7:70571718-70571740 ATCTCAGCCCAGCTGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026455809 Original CRISPR TCCCCAAGGCTCCTCCACAG AGG (reversed) Intronic
900344179 1:2203315-2203337 CCCCCCAGGCTTCTCCATAGTGG + Intronic
900569393 1:3350896-3350918 TCCCCAAGTCCCCTTCAGAGTGG - Intronic
900624915 1:3603668-3603690 TCCCCCAGCCTCCTCATCAGAGG + Intronic
901322020 1:8345825-8345847 TCACCAAGGCCCCTTCTCAGAGG + Intergenic
901628584 1:10637487-10637509 TCCAGAAGCCTCCTCCCCAGAGG - Exonic
901858722 1:12060595-12060617 TCCGCAAGGGTTCTCTACAGGGG + Intergenic
901923619 1:12552659-12552681 GCCCCACGGCGCCTGCACAGAGG + Intergenic
902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG + Intergenic
903390275 1:22959066-22959088 TCCCAAAGGCAGCTCCACAGAGG - Intronic
904798079 1:33072519-33072541 TCAGCAAGCCTCCTTCACAGAGG - Intronic
905539201 1:38746694-38746716 TCCCCAGGGCTCCCAGACAGGGG - Intergenic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
909863096 1:80633401-80633423 TTCCCAGGGCTCCACCTCAGTGG - Intergenic
911176206 1:94820500-94820522 TCCCCGGGGCTCCTCCCCCGAGG - Intronic
912500850 1:110121116-110121138 TCCTCCTGGCTCCTCCACAGGGG + Intergenic
913573289 1:120142922-120142944 TCCACAAGACTCCTCATCAGAGG + Intergenic
914294548 1:146307719-146307741 TCCACAAGACTCCTCATCAGAGG + Intergenic
914555592 1:148758502-148758524 TCCACAAGACTCCTCATCAGAGG + Intergenic
915159632 1:153908834-153908856 TCCCCAAGGCTGGAACACAGTGG + Intronic
915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG + Intergenic
919258551 1:195158296-195158318 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
921269118 1:213451530-213451552 TCTCCTAGGCTCCCACACAGTGG + Intergenic
924359219 1:243218372-243218394 TCCCCCTGCCTCCTCCACTGGGG - Intronic
924408799 1:243781860-243781882 TCACCCAGGCTGCTGCACAGTGG + Intronic
1063910273 10:10821969-10821991 GCCCCAAGGCTTCTCAGCAGGGG - Intergenic
1065969030 10:30791240-30791262 TCCCCACGCCCCCTCCCCAGCGG - Intergenic
1069511675 10:69047352-69047374 GCCCCCAGACTCCTCCTCAGTGG - Intergenic
1069771186 10:70901504-70901526 TCTCCCAGGCTCCTGCCCAGGGG + Intergenic
1069772416 10:70908084-70908106 TCCCCATGGCTTCTCTTCAGTGG + Intergenic
1069898291 10:71692414-71692436 TAGCCAGGGCTGCTCCACAGAGG + Intronic
1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG + Intronic
1070779389 10:79128713-79128735 TCCCCAGGGCACCTCCAGAGTGG + Intronic
1070793439 10:79203202-79203224 TCCCCAAGGTGCCTGCCCAGTGG + Intronic
1072367834 10:94732568-94732590 TCCCAAATGCCCATCCACAGTGG + Intronic
1072625132 10:97106349-97106371 TCCCCTAGTCTCTTCCACATAGG - Intronic
1072761268 10:98058908-98058930 TCCCCAAGGCTCCTTAAGCGTGG - Intergenic
1073138557 10:101232850-101232872 TCCCAGAGTCTGCTCCACAGAGG + Intergenic
1074688526 10:115981506-115981528 TCCACAAGGCCCCTTTACAGTGG + Intergenic
1075697409 10:124447349-124447371 TGCCCTCGGCTCCTCCACCGGGG - Exonic
1076334455 10:129696123-129696145 ACCCCCTGGCTCCTCCCCAGAGG + Intronic
1077089939 11:773817-773839 TCACCAACTCTCCTCCCCAGAGG + Intronic
1083253120 11:61481229-61481251 TCCCCGAGGCCCAACCACAGCGG - Intronic
1083721065 11:64603761-64603783 TTCCCTTGGCTCCTCCATAGCGG - Intergenic
1084376719 11:68782981-68783003 TCCCCACGTCTCCTCCGCTGGGG + Intronic
1084529929 11:69721223-69721245 TCCCCGGGGCTCCTGCACAATGG + Intergenic
1087486680 11:98765337-98765359 TTCCCGAGGCTCCACCTCAGTGG - Intergenic
1088246353 11:107821783-107821805 TCCCCAAGGCAGCTTCACACTGG + Intronic
1088298339 11:108326746-108326768 TCCCCAAGGTTTGTCTACAGTGG + Intronic
1088652676 11:111972327-111972349 TCCCCAAGCCCACTCCACATGGG - Intronic
1089361236 11:117888118-117888140 TCCCCAAGCCTCGTGCACACAGG + Intergenic
1089992139 11:122871446-122871468 TCCCCCAGGCTGGTCCACTGAGG - Exonic
1090707957 11:129356725-129356747 TCCCCAAGGTTCCTGCACCCTGG - Intergenic
1091139674 11:133224214-133224236 TCCCTAAGCCACCTCCAAAGGGG + Intronic
1091266333 11:134274418-134274440 TCTCCAGGGCTCCTTCATAGAGG + Intronic
1091398747 12:170375-170397 TCCCTTAGTCCCCTCCACAGCGG + Intronic
1091688883 12:2582668-2582690 CCCCCAATTCTCCTCCCCAGGGG - Intronic
1092564468 12:9649677-9649699 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
1092587354 12:9912791-9912813 TTCCCAAGGCTCCACCTCAGTGG + Intronic
1095275732 12:40280733-40280755 TCACCAAGGCTGCTGTACAGTGG - Intronic
1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG + Intronic
1096558002 12:52415601-52415623 TCCTCCAGCCTCCTCCACAAGGG + Intergenic
1097233550 12:57525891-57525913 TGCCCCAGGCCCCTCCACCGTGG - Exonic
1098805443 12:75016098-75016120 TTCCCAAGGCTCCACCTCAATGG + Intergenic
1101913695 12:108879921-108879943 CCCCCAAGGCCTGTCCACAGGGG + Intronic
1102522727 12:113488735-113488757 ACCCCAAGGCTTTCCCACAGAGG + Intergenic
1103257721 12:119556618-119556640 GCCCCAGGTCCCCTCCACAGAGG - Intergenic
1104079236 12:125415691-125415713 TCCCCAAGGCACCTCCGCAGTGG + Intronic
1105466225 13:20643791-20643813 TCGCCCAGGCTGCTGCACAGTGG + Intronic
1106361947 13:29039067-29039089 TCCCCAAGGCTCCTCCTGGCTGG - Intronic
1106435872 13:29722394-29722416 TTCCCTAGGCCCCTCCACAGGGG - Intergenic
1106557083 13:30819008-30819030 CTCCCAAGGCTCCACCACATCGG + Intergenic
1107014534 13:35697525-35697547 TCTCTCAGGCTCCTCCACAGAGG - Intergenic
1109012497 13:56969895-56969917 TTCCCGAGGCTCCACCTCAGTGG - Intergenic
1109526848 13:63586716-63586738 TTCCCAAGGCTCCACCCCAGTGG + Intergenic
1113030006 13:105982718-105982740 TCCCCACAGCTCCTGCACTGTGG - Intergenic
1113950439 13:114068553-114068575 TCCCCAAGGCTGCGCTGCAGTGG - Intronic
1116055834 14:39862779-39862801 TTCCCAAGTCTCCACCTCAGTGG + Intergenic
1116390751 14:44386162-44386184 TTCCCAAGGCACCACCCCAGTGG + Intergenic
1116457951 14:45140995-45141017 TCACCAAGGCTGCAGCACAGTGG - Intronic
1116786455 14:49293970-49293992 TTCTCAAGTCTCCTCCAGAGGGG - Intergenic
1118032048 14:61827331-61827353 TCTGCAAGGCACCTACACAGGGG - Intergenic
1119935906 14:78592414-78592436 TCCCCAAGGGTCCAACAGAGAGG + Intronic
1120143591 14:80955517-80955539 TTCTCCAGCCTCCTCCACAGTGG + Exonic
1121492097 14:94368282-94368304 ACCCCAGGGGTGCTCCACAGGGG - Intergenic
1122182620 14:99967109-99967131 TTCCCGAGGCTCCCCCTCAGTGG - Intergenic
1122236695 14:100334593-100334615 TCCCCAAAGCAGCCCCACAGTGG - Exonic
1126578368 15:50219930-50219952 TCACCAAAGCTACTCCTCAGAGG - Intronic
1126870466 15:52981582-52981604 TCTGCAGGGCTCTTCCACAGAGG - Intergenic
1127327649 15:57911409-57911431 TCACCAGGGCTGCTCCCCAGAGG - Intergenic
1128310803 15:66630899-66630921 TCCCCAGTACTCCTCCGCAGAGG - Intronic
1128886571 15:71293616-71293638 TTCTCAAGTTTCCTCCACAGTGG + Intronic
1129517647 15:76166347-76166369 TTCCCAAGCCCTCTCCACAGCGG + Intronic
1130041280 15:80406852-80406874 TCCCCACGGATCATCCTCAGGGG - Intronic
1132157010 15:99502843-99502865 CACCCCAGGCTCCTCCACAGTGG - Intergenic
1132472398 16:112903-112925 TCCCCCAGGCTCCTTTGCAGAGG + Intronic
1132587469 16:711815-711837 TCCCCAGGCCTCCTCCAGAGAGG - Intronic
1132946869 16:2536602-2536624 GCCCCGAGGCTCCTCCACCCTGG + Intergenic
1132952299 16:2570093-2570115 TCCCCAAGGTTCTTGCATAGAGG - Intronic
1132962052 16:2630077-2630099 TCCCCAAGGTTCTTGCATAGAGG + Intergenic
1133021678 16:2969617-2969639 TCCCCGAGCCTCCTCCTCAGTGG - Exonic
1134619203 16:15674968-15674990 TCTCCAAGCCTCATCCACAGGGG - Intronic
1134847426 16:17451708-17451730 AGCTCAAGGCTACTCCACAGCGG - Intronic
1135047865 16:19168975-19168997 TCCCCACGGCCCCTCCCCTGGGG - Intronic
1136475969 16:30513575-30513597 TGTCCAAAGCTTCTCCACAGTGG - Intronic
1136484260 16:30561265-30561287 CCCTCCAGGCTCCTCCACAGGGG - Intergenic
1136518596 16:30782460-30782482 TCCCCAAGGCTCCCTTTCAGAGG - Exonic
1136626361 16:31464561-31464583 TCCCCAAGGCTCCTCGATGGCGG - Exonic
1138533262 16:57646406-57646428 TCCCCAAGGATCCAGCAGAGTGG - Intronic
1140662924 16:77205147-77205169 TCTCCAATTCTCCTCCTCAGAGG - Intronic
1141036440 16:80630355-80630377 CACCCAGGGCTGCTCCACAGAGG + Intronic
1141432476 16:83977570-83977592 TCCACAGAGCCCCTCCACAGAGG + Intronic
1141676598 16:85521010-85521032 TCCCAAAGGCTCCTCAACCCCGG - Intergenic
1141779647 16:86150993-86151015 TCCCCCAGCCTCCTCCACCTGGG - Intergenic
1142397908 16:89843164-89843186 TCCCCAACCCTCCTCCCCCGGGG - Intronic
1142899973 17:3005697-3005719 TGCCCAAGGCTCCTTGACCGGGG - Intronic
1144279913 17:13715869-13715891 TCCCTAATGCTCCTCCTCAAGGG - Intergenic
1146161063 17:30559739-30559761 TCCCCTCGGCTCTTCCCCAGAGG + Intronic
1146946548 17:36877503-36877525 CCCCCAGGGCCCCTCCCCAGTGG - Intergenic
1147143939 17:38474595-38474617 TCCCCAGGACACCTCCACTGGGG - Intronic
1149092224 17:52797510-52797532 TTTCCAAGGGACCTCCACAGAGG + Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151469533 17:74309504-74309526 TGCACACGGCTCCCCCACAGAGG - Intronic
1151481052 17:74370228-74370250 TCCCCATGGGTCCTCCCCATGGG - Intronic
1151804446 17:76396874-76396896 TCCCCAGAGCTCCTCCTTAGTGG - Intronic
1152066539 17:78115504-78115526 TCCCCGAGGCCCCTCCCCTGGGG - Intronic
1152760699 17:82105733-82105755 TTCCCACGGTCCCTCCACAGGGG + Intronic
1152802380 17:82336942-82336964 TCCCCCTAGCTCCCCCACAGAGG - Intergenic
1153530614 18:6042089-6042111 TCCCCAAGCCCTCCCCACAGAGG + Intronic
1153675443 18:7452559-7452581 TCCTCCAGCCTCCTCCACACAGG + Intergenic
1153952493 18:10069071-10069093 TCCCCATGGCTCCTGCAAATGGG - Intergenic
1155593458 18:27454481-27454503 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
1157693252 18:49700777-49700799 GACATAAGGCTCCTCCACAGCGG - Intergenic
1159102351 18:63970627-63970649 TCCCGGAGCCTCCTCCGCAGCGG - Intronic
1161237149 19:3203874-3203896 TCCCCACGGCACCACCACCGCGG - Intronic
1161663330 19:5560459-5560481 TCCCCAAAGACCCTCCCCAGGGG + Intergenic
1163234325 19:16022263-16022285 TCCCCTTGGCTCCTTCCCAGAGG + Intergenic
1163861908 19:19747289-19747311 TCCCCTTGGCTCTTCCCCAGAGG + Intergenic
1164696666 19:30249891-30249913 TCCCCAAGCATTCTCAACAGTGG - Intronic
1167000836 19:46745395-46745417 TCCCCAAAGTTTCTCCTCAGAGG + Intronic
1167522112 19:49961154-49961176 TTCCCGAGGCTCCTCCTCTGTGG - Exonic
1167523270 19:49969571-49969593 TTCCCGAGGCTCCTCCTCTGTGG + Intergenic
1168712913 19:58512024-58512046 GCCCAATGGCTCCTCCCCAGGGG + Exonic
925215940 2:2095939-2095961 TCACCAGGGCTCCTCCTCAGCGG - Intronic
925764118 2:7214468-7214490 TCCACAGGGCTCATCCCCAGAGG + Intergenic
926104606 2:10142416-10142438 CCCGCAAGCCACCTCCACAGTGG - Intronic
927256619 2:21045096-21045118 TCCCCAAGGCACCTCCACTCTGG + Intergenic
927529035 2:23776549-23776571 TTCCCACTACTCCTCCACAGAGG + Intronic
927550511 2:23994956-23994978 TTACCAAGACTCCTCCACATTGG + Intronic
928122274 2:28591784-28591806 GACCCAGGGCCCCTCCACAGGGG + Intronic
928182961 2:29082661-29082683 TTCCCGAGGCTCCACCTCAGTGG + Intergenic
930100647 2:47600525-47600547 TGCCCAAGTCTTCTCCACACAGG - Intergenic
931241200 2:60453775-60453797 TCCCCAAGTATCCTCTAAAGCGG - Intronic
932319329 2:70809465-70809487 TCACCTGGACTCCTCCACAGAGG - Intronic
932414497 2:71565483-71565505 TCCCCAAAGCCCCTCCACGCTGG + Intronic
932443004 2:71749686-71749708 TCCCCAGGGCACCTCAGCAGAGG - Intergenic
933131895 2:78682283-78682305 TCCTCAAGTCTTCCCCACAGTGG - Intergenic
933219986 2:79677289-79677311 TCCCCAACCCTCCTCCTCACAGG - Intronic
933247925 2:79996660-79996682 TCCTCAAGGCTTTTCCAAAGGGG - Intronic
934648020 2:96070588-96070610 TTCCCAAGACCCCTCCACACAGG + Intergenic
934819545 2:97360294-97360316 TTCACAGGGCTCCTCCCCAGGGG - Intergenic
935614426 2:105061707-105061729 TCCCCAATGCTCCTCCCCCCAGG - Intronic
937280011 2:120711294-120711316 CCCCCCAGTCTCCTCCAGAGTGG - Intergenic
940624052 2:156150285-156150307 TTCCCGAGGCTCCACCTCAGAGG + Intergenic
943613390 2:190062333-190062355 TACCCAAAGCTCCTCCACTCCGG - Exonic
944857829 2:203785351-203785373 TCTCCAAGGCCCCACCAGAGTGG + Intergenic
944861477 2:203819461-203819483 CCCCACAGGCTCCTCCACACTGG - Intergenic
946025721 2:216670659-216670681 TCCCCAGTGCTCCTCCCCAGAGG - Intergenic
946131161 2:217608076-217608098 TCCCGACTGCTCCTCCCCAGAGG + Intronic
946131984 2:217613475-217613497 TCCCCAAAGCTCATCAACAAAGG - Intronic
946194345 2:218024208-218024230 TCCCCAAGGCTTCAACTCAGAGG - Intergenic
947573249 2:231251763-231251785 TCACCAAGGCTGCACCGCAGTGG + Intronic
948050483 2:234976147-234976169 TCCGCAGGAGTCCTCCACAGGGG - Intronic
948385431 2:237577832-237577854 CCCCCCATCCTCCTCCACAGTGG - Intronic
948541708 2:238695824-238695846 TCACCAGGGCTGCTCCACTGTGG - Intergenic
948746139 2:240095626-240095648 CACCCAAGGCTCCTGCACCGGGG - Intergenic
948749647 2:240124313-240124335 TCCCCCAGGCCCCTCCAGAGTGG + Intergenic
948804982 2:240449843-240449865 TCCTCAAGGTTCCTCCACGCCGG + Exonic
1169301238 20:4443588-4443610 TCCCCAAAGTCCCTCCACACTGG - Intergenic
1170645117 20:18190953-18190975 TCCCCAAGGCTTAGCCAGAGCGG - Intergenic
1171004285 20:21448882-21448904 TCCCAAATTCTCCTCCAAAGGGG + Intergenic
1172185500 20:33028676-33028698 CCCCCAAGGTTCATTCACAGGGG - Intergenic
1172312278 20:33927965-33927987 TCCCCAAGCCTTGTCCACTGGGG - Intergenic
1174357318 20:50007154-50007176 ACCCCAAGTTTCCTCCACAGAGG - Intergenic
1175166665 20:57048887-57048909 TCCCCCAAGCTCCTCCAGAGGGG - Intergenic
1175594611 20:60220967-60220989 CCCCGAAGGCCCCTCCCCAGTGG - Intergenic
1175996019 20:62812684-62812706 TCCCCCTGGCTCCTCTCCAGGGG - Exonic
1176053672 20:63133888-63133910 TCTCCAAGGTTCCTGCTCAGAGG + Intergenic
1176173488 20:63707145-63707167 TCCCCCGGGCTTCTCCACGGTGG + Intronic
1177288500 21:19080468-19080490 TCCCCAGGCCTCCCCAACAGCGG - Intergenic
1177402411 21:20623271-20623293 TCCACAAGGCTGTTCCAAAGTGG + Intergenic
1178352852 21:31885335-31885357 CCACCAAGGCTGCTCCTCAGAGG - Intronic
1179984814 21:44914351-44914373 TCACCAAGTCCCCTGCACAGGGG + Intronic
1180134726 21:45855096-45855118 GCCCCCAGGCTCCACCACGGAGG + Intronic
1181038862 22:20182549-20182571 TCCTCTGGGCTCCTGCACAGCGG + Intergenic
1181157770 22:20935150-20935172 TCACCCAGGCTCCAGCACAGTGG + Intronic
1181466642 22:23113982-23114004 TCCCCAAGCTTCCACCACAAAGG + Intronic
1181474307 22:23159039-23159061 TCCCCATGGCTCCTCCAATGAGG - Intronic
1183366531 22:37409911-37409933 TCCCAAGGCCTCCTCCCCAGAGG - Intronic
1183680561 22:39326473-39326495 TCCCCAGGGGTCCTCCTCAAGGG + Intergenic
1183722811 22:39572236-39572258 TCCCCAAGCCTCCTCCTCAGTGG - Intronic
1183943008 22:41306939-41306961 GCCCCCAGGAGCCTCCACAGAGG + Intronic
1184764508 22:46564485-46564507 GCCCCCAGGCTCCTCCTCTGTGG - Intergenic
1184859213 22:47163663-47163685 TGTCCCAGGCTCCTGCACAGAGG - Intronic
1185383646 22:50521762-50521784 TCCCAGAGCCTCCTCCACACAGG - Exonic
949984688 3:9531451-9531473 TCCCCCAGGCTACTTCTCAGAGG - Intronic
950839927 3:15958171-15958193 GGGCCAAGGCTGCTCCACAGAGG + Intergenic
951193800 3:19802344-19802366 TTCCCTAGGCTCCACCGCAGTGG + Intergenic
951624115 3:24641557-24641579 CCCAGAAAGCTCCTCCACAGTGG + Intergenic
952235848 3:31479445-31479467 TGCCCAAGGCCCATCCTCAGTGG + Intergenic
953378389 3:42447745-42447767 TCCCAAAGGCCCCTCCACCTGGG + Intergenic
954861065 3:53690743-53690765 TCCACAGTGCTCCTCCACAGTGG + Intronic
955993814 3:64657374-64657396 TCTCCAAGGCTGATGCACAGTGG + Intronic
957073735 3:75585064-75585086 TCTCCAAGGCACCTCAAAAGAGG + Intergenic
957952148 3:87141153-87141175 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
957952704 3:87145858-87145880 TTCCCGAGGCTCCACCTCAGTGG - Intergenic
958781800 3:98551830-98551852 TCTACAAAACTCCTCCACAGAGG + Intronic
959661670 3:108875419-108875441 TCTCCAAGGTTCTTCCACAGAGG - Intergenic
961408313 3:126699121-126699143 TCCCCAAGGATTCTTCACAGTGG + Intergenic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
962977221 3:140456245-140456267 TCCCCATTGCACCTCCTCAGTGG - Intronic
964639351 3:158892183-158892205 TCCCTAAGGCAACTTCACAGTGG - Intergenic
965729428 3:171755127-171755149 ACCCCAAGGCTTCTAAACAGGGG + Intronic
966523109 3:180894520-180894542 TTCCCGAGGCTCCACCTCAGTGG - Intronic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
968862550 4:3184360-3184382 CTCTCAAGGCTCCTCCACACTGG - Intronic
969138291 4:5048793-5048815 TGCCCCAGTCTCCTCCAGAGTGG + Intergenic
969423522 4:7110747-7110769 CCCTCCAGGCCCCTCCACAGTGG - Intergenic
971718881 4:30218573-30218595 GCACCAAGGATACTCCACAGGGG - Intergenic
971792170 4:31183834-31183856 TTCCTAAGGCTCCACCTCAGTGG + Intergenic
972555472 4:40176773-40176795 TTCCCGAGGCTCCACCTCAGTGG - Intergenic
974011804 4:56613950-56613972 TCCTCAAGGCACCACCACATAGG + Intergenic
982484373 4:155949965-155949987 AATCCAAGGCTCCTCAACAGTGG - Intronic
983321122 4:166198209-166198231 TTCCCAAGGCTCCACCCCAGTGG - Intergenic
983862141 4:172720428-172720450 TTCCCGAGGCTCCACCTCAGTGG + Intronic
985385929 4:189448238-189448260 TTCCCGAGGCTCCACCTCAGTGG - Intergenic
985579534 5:689611-689633 TCACCAAGGCTCCACCACCCAGG - Intronic
985594380 5:781670-781692 TCACCAAGGCTCCACCACCCAGG - Intergenic
985920769 5:2971009-2971031 TCCCCAAGGGCAGTCCACAGTGG - Intergenic
986288021 5:6374909-6374931 CCCCTGAAGCTCCTCCACAGAGG - Intronic
986297347 5:6449886-6449908 CACACAAGGCTCCTCCGCAGGGG + Intronic
987910750 5:24141094-24141116 TTCCCAAGGCTCTACCTCAGTGG - Intronic
988899538 5:35717747-35717769 TTCCCAAGGCTCCACCTTAGTGG + Intronic
989240012 5:39193113-39193135 TCCCCAAGTCTCCTACTCTGAGG - Intronic
991014446 5:61915946-61915968 TTCCCAAGTCTCCTCCCCAGTGG - Intergenic
991501681 5:67283133-67283155 TGCCCCAGCCTGCTCCACAGAGG + Intergenic
995830442 5:116348799-116348821 TTCCCGAGGCTCCACCTCAGTGG + Intronic
996661514 5:126009098-126009120 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
998481868 5:142469668-142469690 TCCCCCAGCCTCCTCAACACAGG - Intergenic
999321007 5:150615108-150615130 CCCCCACAGCTCCTGCACAGAGG + Intronic
999553611 5:152717530-152717552 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
1001416125 5:171545737-171545759 TCCCCAAGGCCGCTCAACAAGGG - Intergenic
1001932260 5:175681569-175681591 TCTCCAAGGCTCCCTCCCAGTGG - Intronic
1002194343 5:177494257-177494279 ACCCTAAGGCTCCACCACTGTGG + Intronic
1002312520 5:178323361-178323383 TCCCCAAGGCCCCTACTCTGTGG + Intronic
1005834116 6:29695081-29695103 TCCCCAAGCCTGCCCCACAATGG + Intergenic
1006379773 6:33690789-33690811 TTCCCAAGGCTCCTCCAGGGAGG - Intronic
1006399268 6:33807005-33807027 TTCCCAGGGCCCCTCCACACTGG + Intergenic
1007283534 6:40730469-40730491 TCCCCAAGGCTATTCCCCAAGGG - Intergenic
1009907482 6:69887904-69887926 TTCCCAAGGCTCCATCTCAGTGG + Intronic
1009908371 6:69895650-69895672 TTCCCAAGGCTCCACCTCAGTGG + Intronic
1010176377 6:73032846-73032868 TCAGTAAGGCTCCTCCACAAAGG + Intronic
1010669743 6:78674032-78674054 TTCCCAAGGCTCCACCCCAGTGG + Intergenic
1013410086 6:109876249-109876271 TTCCCCAGGCTCCACCTCAGTGG - Intergenic
1016161937 6:140893607-140893629 TTCCCGAGGCTCCACCTCAGTGG + Intergenic
1016162506 6:140898469-140898491 TTCCCCAGGCTCCACCCCAGTGG + Intergenic
1019010688 6:168841675-168841697 TCCCCCAGCGTCCTGCACAGGGG - Intergenic
1019112862 6:169730998-169731020 TCCCCTAGGCTCCTCCACCTAGG - Intergenic
1020676654 7:11192004-11192026 TTCCCGAGGCTCCACCCCAGTGG - Intergenic
1020677335 7:11197546-11197568 TCCCCAAGGCTCCACCTCAGTGG - Intergenic
1023176701 7:37442476-37442498 TCACCATGACTCATCCACAGAGG + Intronic
1024343168 7:48287300-48287322 TCCACAAGGCTCTTCCCCAAAGG - Intronic
1025168900 7:56738037-56738059 TCCCCAAGGCTGGTGTACAGTGG - Intergenic
1025638817 7:63349096-63349118 CCCCCCAGGCACCTCCAGAGCGG - Intergenic
1025643879 7:63398993-63399015 CCCCCCAGGCACCTCCAGAGCGG + Intergenic
1025703489 7:63841860-63841882 TCCCCAAGGCTGGTGTACAGTGG + Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1026502118 7:70951837-70951859 TCTCCAAGGCTCACTCACAGTGG - Intergenic
1026671407 7:72393787-72393809 TCACCCAGGCTGCTGCACAGTGG + Intronic
1027660407 7:80981609-80981631 TTCTCAAGGCTCCACCTCAGTGG + Intergenic
1030139680 7:106291911-106291933 TTCCCAAGTCTCCCCCTCAGTGG - Intergenic
1030245924 7:107384370-107384392 TTCCCGAGGCTCCACCTCAGTGG - Intronic
1032333366 7:131001032-131001054 TCCCAGAAGCTCCTACACAGTGG - Intergenic
1033527348 7:142229556-142229578 ACCCCAAGGTTCTTCCTCAGGGG - Intergenic
1035202836 7:157278116-157278138 CCCCAAAGGCTCCTGCACACTGG - Intergenic
1035265268 7:157686560-157686582 CCCCCAAGGCTGCACCACGGCGG + Intronic
1037765805 8:21771540-21771562 TCCCCAAGGCTTCTGGACATTGG + Intronic
1038208624 8:25493821-25493843 TGCCAAATACTCCTCCACAGAGG - Intronic
1038446934 8:27611010-27611032 TCCCCATGCCACCTCCACAGAGG + Intronic
1040561001 8:48523480-48523502 TCCCTAAGGCTCCCGCACAGAGG + Intergenic
1040776125 8:51045072-51045094 GACCCAATGCTCTTCCACAGTGG + Intergenic
1040876990 8:52163929-52163951 TCATCCAGGCTCCTGCACAGCGG - Intronic
1041307025 8:56472134-56472156 TCTCCAAGCCTCCTCTACAAAGG + Intergenic
1041773633 8:61499553-61499575 ACCCCAATGCTCCTGCACACTGG + Exonic
1042871048 8:73400106-73400128 GCCCCAGGTCTCCTCCACAGAGG - Intergenic
1043983051 8:86662629-86662651 TTTCCAAGGCTCCACCTCAGTGG - Intronic
1045131828 8:99163016-99163038 TCTCCAAGGCCCCACCAGAGCGG + Intronic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1045511403 8:102814594-102814616 TCCTCCTGGCTCCTCCACAAAGG + Intergenic
1048625690 8:136182623-136182645 TCCTCAAGGCTCATGCAAAGAGG - Intergenic
1049451585 8:142664864-142664886 TGCCGAAGGCTCCTCCTCTGAGG - Exonic
1049539010 8:143198125-143198147 TCCCCAAAGCTCTTCCACTGTGG + Intergenic
1050144410 9:2550774-2550796 ACCCCAGGCCACCTCCACAGTGG - Intergenic
1050992611 9:12172469-12172491 TACCCGAGGCTCCTCTGCAGAGG + Intergenic
1051997027 9:23229918-23229940 CCCGCAGTGCTCCTCCACAGTGG + Intergenic
1052362317 9:27573954-27573976 GCGCCAACGCTCCTCCAGAGCGG - Intergenic
1052365752 9:27610728-27610750 AGCCCCAGGCTCCTCCACAGCGG + Intergenic
1055513411 9:77016200-77016222 TCCCCCAGGATCCTCCGCGGCGG + Intergenic
1055795820 9:79973907-79973929 TGGCCAAGGCTTCTCCACTGTGG - Intergenic
1056741194 9:89256825-89256847 TCCCAGAGGCTCCTCCACAGGGG - Intergenic
1057604901 9:96492203-96492225 TCCCCAAGTCTCCTGAAAAGTGG + Intronic
1057786105 9:98088157-98088179 TCCCCAAGACCCCGCCCCAGGGG - Intronic
1058109685 9:101018540-101018562 TCCCAAGGGCTCCTGCACTGCGG - Intergenic
1059392336 9:114007130-114007152 TCCCCAAGGCTGCTCATCACCGG + Intronic
1060262072 9:122084499-122084521 TCCCTGAGATTCCTCCACAGAGG - Intronic
1060521961 9:124299058-124299080 CCCGCTAGGCTCCTCCCCAGTGG + Intronic
1060525653 9:124319967-124319989 TGACCAAGGTTCTTCCACAGGGG + Intronic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1060734143 9:126055605-126055627 TCCCGCAGGCACCTCCAGAGGGG - Intergenic
1061192657 9:129090760-129090782 TCCTCAAGGCTGTCCCACAGAGG - Intergenic
1061281077 9:129597827-129597849 TCCCGAATGCCCCTCCCCAGAGG - Intergenic
1061323803 9:129849805-129849827 TCCCCCAGGCTCCTTGCCAGAGG + Exonic
1061372180 9:130203603-130203625 TGACCAAGGCACCTCCCCAGGGG + Intronic
1061532826 9:131228338-131228360 TTCCCAAGGGCCCTCCCCAGGGG - Intronic
1061607681 9:131723571-131723593 TCCTCAAGGTTCATCCACACTGG + Intronic
1061873318 9:133532001-133532023 TCCCCAGGGAACCTCCAAAGTGG + Intergenic
1062109624 9:134774801-134774823 TTCCCCAGGCACCTCCACACTGG + Intronic
1062381591 9:136289575-136289597 CCCCCATGGCTCCCCCACAAGGG + Intronic
1197388272 X:125827196-125827218 TTCCCCAGGCTCCACCCCAGTGG - Intergenic
1199050127 X:143228428-143228450 TCTCCAAGGCCCCACCAGAGCGG + Intergenic
1199832896 X:151562723-151562745 TCCGCAAGGCTCCTGCGCACAGG + Intergenic
1200166347 X:154038257-154038279 TCCCCAAGGCTGTCCCCCAGGGG + Intronic
1200981318 Y:9265623-9265645 CCGCCAATGCACCTCCACAGAGG + Intergenic
1202129104 Y:21594111-21594133 CCACCAACGCACCTCCACAGAGG - Intergenic