ID: 1026463257

View in Genome Browser
Species Human (GRCh38)
Location 7:70632806-70632828
Sequence CCGAGCAAACAGACTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026463249_1026463257 26 Left 1026463249 7:70632757-70632779 CCACAGCTCATGCCATTAATGGA 0: 1
1: 0
2: 1
3: 4
4: 107
Right 1026463257 7:70632806-70632828 CCGAGCAAACAGACTTCTGTGGG No data
1026463250_1026463257 14 Left 1026463250 7:70632769-70632791 CCATTAATGGAGTCATAATAGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1026463257 7:70632806-70632828 CCGAGCAAACAGACTTCTGTGGG No data
1026463247_1026463257 27 Left 1026463247 7:70632756-70632778 CCCACAGCTCATGCCATTAATGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1026463257 7:70632806-70632828 CCGAGCAAACAGACTTCTGTGGG No data
1026463253_1026463257 -7 Left 1026463253 7:70632790-70632812 CCACGGTTGGCTTTTCCCGAGCA 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1026463257 7:70632806-70632828 CCGAGCAAACAGACTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026463257 Original CRISPR CCGAGCAAACAGACTTCTGT GGG Intronic
No off target data available for this crispr