ID: 1026466842

View in Genome Browser
Species Human (GRCh38)
Location 7:70661771-70661793
Sequence CCTGCTCGTGCAACACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026466842_1026466847 8 Left 1026466842 7:70661771-70661793 CCAGGCTGTGTTGCACGAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1026466847 7:70661802-70661824 ACAGGCCCAGCACTGACCTCAGG No data
1026466842_1026466845 -10 Left 1026466842 7:70661771-70661793 CCAGGCTGTGTTGCACGAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1026466845 7:70661784-70661806 CACGAGCAGGGCCTCTGCACAGG No data
1026466842_1026466851 27 Left 1026466842 7:70661771-70661793 CCAGGCTGTGTTGCACGAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1026466851 7:70661821-70661843 CAGGTTTAACCTTTTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026466842 Original CRISPR CCTGCTCGTGCAACACAGCC TGG (reversed) Intronic
900499300 1:2992584-2992606 CTTGCTTCTGCAACACAGGCGGG - Intergenic
900577862 1:3393172-3393194 CTTGCCCGTGCAACACAACCCGG + Intronic
901037038 1:6342482-6342504 CCTGCCTGGGCAACACAGCAAGG - Intronic
901197620 1:7448930-7448952 CCTGTGTGTGCAAAACAGCCTGG - Intronic
902164338 1:14557839-14557861 CCAGCTCCTGCTACAGAGCCTGG + Intergenic
902452716 1:16507959-16507981 CCTGCCACTGCAATACAGCCTGG - Intergenic
902472775 1:16660630-16660652 CCTGCTACTGCAATACAGCCTGG - Intergenic
902486029 1:16746813-16746835 CCTGCTACTGCAATACAGCCTGG + Intronic
902499769 1:16902263-16902285 CCTGCCAGTGCAATACAGCCTGG + Intronic
902823211 1:18956110-18956132 CCAGCTCGTGCACCTTAGCCAGG + Exonic
903221305 1:21871025-21871047 CCTGTTCGTTGGACACAGCCAGG - Intronic
903370511 1:22832136-22832158 CCTGCTGTTGCACCCCAGCCTGG - Intronic
903864977 1:26391472-26391494 CCTGCTGGTGCCACAAGGCCTGG + Intergenic
904324641 1:29720389-29720411 CCTTGTCCTGCAACTCAGCCAGG + Intergenic
904723146 1:32526104-32526126 GCTGCTCTTGCAGCTCAGCCTGG - Intronic
907514985 1:54988228-54988250 CCTGCTCCTCCCACCCAGCCAGG + Intronic
908238305 1:62168307-62168329 CTTGATCGTGCACTACAGCCTGG + Intergenic
910634124 1:89387901-89387923 CCAGCCCGGGCAACAGAGCCTGG + Intergenic
910960850 1:92761026-92761048 CCAGCCCGGGCAACACAGCGAGG + Intronic
913242487 1:116841336-116841358 CCTGCTACTGCACTACAGCCTGG - Intergenic
914097075 1:144553179-144553201 CCTGCCACTGCAATACAGCCTGG - Intergenic
914301921 1:146384431-146384453 CCTGCCACTGCAATACAGCCTGG + Intergenic
914374294 1:147060173-147060195 CCTGCTACTGCACTACAGCCTGG - Intergenic
916517184 1:165530295-165530317 CCAGCTTGTGCCACAAAGCCTGG - Intergenic
916557718 1:165907694-165907716 CCTCATCGTGCAGCACATCCAGG + Exonic
918292104 1:183118940-183118962 CATGCTATTGCACCACAGCCTGG - Intronic
919540738 1:198842345-198842367 CCTACGTGTGGAACACAGCCAGG + Intergenic
920882398 1:209892698-209892720 CCAGCTCTTGGAACAGAGCCTGG + Intergenic
921971443 1:221153528-221153550 CATGCTTCTGCACCACAGCCTGG - Intergenic
924306360 1:242692918-242692940 TCTGCTCCTCCATCACAGCCAGG - Intergenic
1067401916 10:45983771-45983793 CCAGCTCAGGCAACACAGCAAGG - Intronic
1067790812 10:49286304-49286326 CATGCTAGTGCACCCCAGCCTGG + Intergenic
1067870270 10:49953373-49953395 CCAGCTCGGGCAACACAGCAAGG - Intronic
1071681174 10:87707105-87707127 CCTGCTAGTGAGACAGAGCCAGG - Intronic
1075671431 10:124266189-124266211 CCTGCTCTTTCTGCACAGCCAGG - Intergenic
1076809526 10:132879382-132879404 CCTGCTCCTGCAGCACCTCCCGG - Intronic
1077179472 11:1205815-1205837 ACTGCTCCTGCAACACGGCGAGG - Intergenic
1078607385 11:12788943-12788965 CCAGCGTGGGCAACACAGCCAGG - Intronic
1084687629 11:70706269-70706291 CCAGATCCTACAACACAGCCTGG + Intronic
1087705917 11:101491868-101491890 CCAGCCTGGGCAACACAGCCAGG - Intronic
1089407716 11:118212295-118212317 CCGGCTCTTGCAACACCTCCTGG + Intronic
1091992683 12:4968954-4968976 CCTGCTCCTGCAACATAACTGGG - Intergenic
1092859977 12:12712039-12712061 TCTGCTTGTCCAAGACAGCCTGG + Intergenic
1096477302 12:51916037-51916059 CCTGTGAGTGCATCACAGCCAGG - Exonic
1100109413 12:91220177-91220199 CCTGCTCTTGAAACTCAGACAGG + Intergenic
1101575889 12:105995930-105995952 CCTGCACTTGCCACCCAGCCTGG - Intergenic
1101605492 12:106245636-106245658 CCTGCCAGTGCACCCCAGCCGGG - Intronic
1103054399 12:117807177-117807199 CCTGCTCAAGAAACAAAGCCGGG + Intronic
1103524621 12:121559450-121559472 CCTGTTCATGCCACACAGCTGGG + Intronic
1104460065 12:128948091-128948113 CGTGCTCGTGAAACCCAGGCAGG + Intronic
1105071725 12:133237954-133237976 CCAGCCTGTGCAACACAGCAAGG - Intergenic
1111420169 13:88000645-88000667 GGTTCACGTGCAACACAGCCTGG + Intergenic
1112102300 13:96202601-96202623 CCTTCTCGGGCAACTCTGCCAGG - Intronic
1118194398 14:63611304-63611326 CCAGCTTGGGCAACAGAGCCAGG + Intronic
1120837775 14:89056700-89056722 CCTGCTGGGGCAACAGTGCCAGG + Intergenic
1122628773 14:103097939-103097961 CCTGCCCGAGCCCCACAGCCGGG - Intergenic
1124119324 15:26875624-26875646 CATGCACCTGCCACACAGCCTGG - Intronic
1128185321 15:65639666-65639688 CCAGCTCATGCTCCACAGCCTGG + Exonic
1129879329 15:78996605-78996627 CCTGCTCTTTCATCACACCCAGG + Intronic
1130827501 15:87564793-87564815 CCATCTCCTGCAGCACAGCCTGG + Intergenic
1131629308 15:94159124-94159146 CCAGCTTGGGCAACACAGCAAGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1132946297 16:2533002-2533024 CCAGCCTGCGCAACACAGCCAGG - Intergenic
1133499699 16:6354174-6354196 CATGCTAGTGCACCCCAGCCTGG + Intronic
1133525835 16:6604370-6604392 CCTGCTTGGGCAACAAAGCAAGG - Intronic
1134092140 16:11397153-11397175 CCTGCACCTAGAACACAGCCTGG + Intronic
1135638677 16:24100995-24101017 CCAGCTGGTGCAACCCAGACTGG - Intronic
1141028549 16:80569458-80569480 TCTGCTCCTGCCTCACAGCCAGG + Intergenic
1144780998 17:17808475-17808497 CCTGCCTGGGCAACACAGCCAGG - Intronic
1144890551 17:18491676-18491698 CCTGCTGGTGCAAATCAGGCCGG + Intronic
1145141667 17:20452642-20452664 CCTGCTGGTGCAAATCAGGCCGG - Intronic
1145767382 17:27468263-27468285 CCAGCCTGGGCAACACAGCCAGG - Intronic
1145809040 17:27753815-27753837 CCTGCTGGTGCAAATCAGGCCGG + Intergenic
1146624575 17:34425417-34425439 CCTGCTCCTGCAAGTCAGGCTGG - Intergenic
1147405126 17:40205932-40205954 CCAGCTTGGGCAACAGAGCCAGG + Intergenic
1150663403 17:67106736-67106758 CCTTCTCCTGCCACTCAGCCTGG - Intronic
1152140283 17:78532481-78532503 CCTGCTCCTGGAACTGAGCCAGG + Exonic
1152597712 17:81246038-81246060 CCGGCTGGCGTAACACAGCCTGG + Exonic
1152726293 17:81948341-81948363 CCTGGTCCTGCAGGACAGCCTGG + Intergenic
1152726310 17:81948426-81948448 CCTGGTCCTGCAGGACAGCCTGG + Intergenic
1154369917 18:13750755-13750777 CCTGCCACTGCAATACAGCCTGG + Intronic
1154473356 18:14725933-14725955 CCAGCCCTGGCAACACAGCCGGG - Intergenic
1155028745 18:21965696-21965718 CCAGCTTGGGCAACACAGCAAGG + Intergenic
1156486912 18:37472199-37472221 CCTCCTCTTCCAGCACAGCCAGG + Intronic
1160818571 19:1047494-1047516 CCTGCTCCTCCAGCAGAGCCAGG - Exonic
1161551100 19:4912801-4912823 CGTGCCACTGCAACACAGCCTGG - Intronic
1162939865 19:14002670-14002692 CCTGCTTGTGCTACAGAGCCAGG + Intronic
1166091551 19:40512664-40512686 CCTGCTCCTGCAGCTCCGCCAGG - Exonic
1166557086 19:43707437-43707459 CCAGCTTGGGCAACAGAGCCAGG - Intergenic
1167562607 19:50234757-50234779 CCTGCGCCTGCCACACAGCAGGG - Intronic
1167816004 19:51881769-51881791 CCTGCTCCTTCCACACAGACAGG + Intronic
1168421880 19:56209732-56209754 CCTGCTACTGCAATCCAGCCTGG - Intergenic
1202705168 1_KI270713v1_random:17449-17471 CCTGCCACTGCAATACAGCCTGG - Intergenic
925099354 2:1232101-1232123 CCTGCTTCTGCAGCACTGCCCGG + Intronic
925921070 2:8638300-8638322 TGTGCTCGTGCAAGACAGCCCGG - Intergenic
927144954 2:20157543-20157565 AATGGTCATGCAACACAGCCGGG - Intergenic
927152840 2:20205611-20205633 CCTGATGCTACAACACAGCCTGG + Intronic
927705867 2:25296290-25296312 CCTGCCCCAGCACCACAGCCCGG - Intronic
928120006 2:28577214-28577236 ACTGCTGGTGCCAGACAGCCAGG - Intronic
930199723 2:48541307-48541329 CCTGCTACTGCATCCCAGCCTGG + Intronic
931352831 2:61507376-61507398 CCAGCTTGGGCAACACAGCAAGG + Intronic
931977654 2:67660806-67660828 CCTCCTCCTGTACCACAGCCTGG + Intergenic
933713053 2:85341727-85341749 CCAGCTCGTCCACCACCGCCCGG + Intergenic
942585133 2:177466691-177466713 CGTGCTGTTGCAACCCAGCCGGG - Intronic
942950410 2:181714680-181714702 CCTACTCGTGCAATACTGCAGGG + Intergenic
945544418 2:211132321-211132343 TCTGCTCATGAAACACAGCTTGG - Intergenic
945621655 2:212147032-212147054 CCTGCCACTGCAAGACAGCCTGG - Intronic
1169158296 20:3353428-3353450 CCAGCCCGGGCAACACAGCAAGG + Intronic
1170867741 20:20174990-20175012 CCTGCACCTGCAAGTCAGCCAGG + Intronic
1171024311 20:21614782-21614804 CCTGCTGGTGCCACAGAGCAGGG + Intergenic
1172306831 20:33886630-33886652 CCAGCTCCTACAACAGAGCCTGG + Intergenic
1172317064 20:33964072-33964094 CCTGCTCCTGCAGGATAGCCAGG + Intergenic
1172930347 20:38582046-38582068 CCCACTCCTGCCACACAGCCAGG - Intronic
1174397567 20:50257286-50257308 CCTGCGCCTGGCACACAGCCTGG + Intergenic
1176362379 21:6008705-6008727 CCTGCCCCTGCAACGCATCCTGG + Intergenic
1176801129 21:13431933-13431955 CCAGCCCTGGCAACACAGCCGGG + Intergenic
1177409313 21:20708979-20709001 AATGATCGTGCAACACAGCCAGG + Intergenic
1179372372 21:40818183-40818205 CCTGTCCCTGCAACACTGCCTGG + Intronic
1179761139 21:43529840-43529862 CCTGCCCCTGCAACGCATCCTGG - Exonic
1181011954 22:20046341-20046363 CCAGCTTGTGCAACACAGCAAGG - Intronic
1181116843 22:20636705-20636727 CCTGCTCATGGAACACAGCAAGG + Intergenic
1181313768 22:21959423-21959445 CCTGCTCTTTCAACCCAGCCAGG + Intronic
1185239373 22:49734527-49734549 CCTGGCCGTGGGACACAGCCCGG - Intergenic
949408605 3:3740461-3740483 CCTGCTCCTTCAAAAGAGCCTGG - Intronic
949493799 3:4612841-4612863 CCTGCTCCTGCACTCCAGCCTGG + Intronic
949783867 3:7719183-7719205 CCTGCTTGTCCTAGACAGCCTGG + Intronic
950515065 3:13459823-13459845 GCTGCTCATGGAACTCAGCCAGG - Intergenic
955330136 3:58040522-58040544 CCTGCTCTTGTCACACAGTCTGG + Intronic
957079446 3:75623786-75623808 CCTCCTCGTGCCTTACAGCCTGG - Intergenic
957505014 3:81108245-81108267 CCTGCTACTGCACCCCAGCCTGG - Intergenic
961349243 3:126288499-126288521 CCTGCTTCTGCAGCCCAGCCTGG + Intergenic
964572445 3:158123491-158123513 CCAGCTTGGGCAACACAGCAAGG - Intronic
968314858 3:197715243-197715265 CGTGCCACTGCAACACAGCCTGG + Intronic
968565486 4:1310431-1310453 CTTGCTGGTGCCACGCAGCCTGG - Intronic
968703505 4:2067502-2067524 CCAGCACCTGCCACACAGCCAGG - Exonic
969276821 4:6141390-6141412 CCTGCTACTGCACCCCAGCCTGG + Intronic
970304954 4:14721605-14721627 CCTGCTCCTGCAAGACTACCAGG + Intergenic
970367101 4:15371136-15371158 CCTGCAAGGGCAGCACAGCCTGG - Intronic
971869878 4:32220925-32220947 CATGCCACTGCAACACAGCCTGG - Intergenic
974563816 4:63556638-63556660 CCTGCCTGTGCAATACAGCAAGG + Intergenic
975697265 4:77025499-77025521 CCTGCTCCTGCACTCCAGCCTGG + Intronic
981099757 4:140817037-140817059 CCTGCTGGTGATAAACAGCCTGG + Intergenic
981271791 4:142854225-142854247 ACTGCCCGTTCAACCCAGCCTGG + Intergenic
983091752 4:163511793-163511815 CCTGCTCGAGCTACACAGTGAGG + Intronic
985445932 4:190021405-190021427 CCTGCTCCTCCAGCAGAGCCCGG + Intergenic
986609941 5:9557113-9557135 ACTGGTCGTCCAACACAGCATGG - Intergenic
986972147 5:13349382-13349404 TCTCCTGGAGCAACACAGCCTGG - Intergenic
987098987 5:14576089-14576111 CCAGCTTGTGCAATACAGCCAGG - Intergenic
988509821 5:31855441-31855463 CCTGCCCGTCACACACAGCCGGG - Intronic
997597877 5:135119202-135119224 GGTGCTAATGCAACACAGCCCGG - Intronic
997635939 5:135405662-135405684 CCAGCTTGGGCAACAGAGCCAGG + Intergenic
998299010 5:141000312-141000334 CCAGCTTGGGCAACACAGCAAGG + Intronic
1001674603 5:173501472-173501494 ACTGCACGGGTAACACAGCCAGG - Intergenic
1003886538 6:10526597-10526619 CCTGCCTAGGCAACACAGCCAGG - Intronic
1005941408 6:30562949-30562971 GCTGCTTGTGAAACTCAGCCAGG + Exonic
1008622088 6:53280620-53280642 CCAGCCTGAGCAACACAGCCAGG - Intronic
1014440662 6:121470205-121470227 CCTGCCTGGGCAAAACAGCCAGG + Intergenic
1018710870 6:166497521-166497543 CGGGCACGTGGAACACAGCCAGG + Intronic
1019108523 6:169690398-169690420 CCAGCTCTTACAACACAGCAGGG + Intronic
1019136453 6:169911629-169911651 CCTGCTCGTGCCACCTGGCCTGG - Intergenic
1026466842 7:70661771-70661793 CCTGCTCGTGCAACACAGCCTGG - Intronic
1033901296 7:146144179-146144201 CCAGCTGGGGCAACAAAGCCAGG - Intronic
1035976893 8:4322939-4322961 CGTGCCCCTGCAACCCAGCCTGG + Intronic
1038183337 8:25249194-25249216 CCAGCTAGGGCAACACAGCAAGG - Intronic
1039398722 8:37249297-37249319 CATTCCCCTGCAACACAGCCTGG + Intergenic
1041790098 8:61685830-61685852 CATGCTAGTGCACTACAGCCTGG - Intronic
1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG + Intergenic
1043927426 8:86053169-86053191 TCTCCTCGCACAACACAGCCTGG + Intronic
1048000557 8:130376260-130376282 CCTGCTGGGTCCACACAGCCAGG + Intronic
1049433980 8:142577794-142577816 CCAGCTGGTGGAACACAGCCAGG - Intergenic
1051991346 9:23155940-23155962 CCTGTTGGTGCATGACAGCCAGG - Intergenic
1052656006 9:31362034-31362056 CCTGCCTCTGCAACCCAGCCTGG - Intergenic
1052673895 9:31594352-31594374 CCAGCTAGAGCAACATAGCCAGG + Intergenic
1052706308 9:31997600-31997622 CGTGCCAGTGCACCACAGCCTGG - Intergenic
1052964278 9:34327789-34327811 CATGCTAGTGCACTACAGCCTGG + Intronic
1055464844 9:76554333-76554355 CGTGCTACTGCACCACAGCCTGG + Intergenic
1059153149 9:111967083-111967105 CAAGGTCTTGCAACACAGCCTGG + Intergenic
1060693595 9:125686868-125686890 CATGCTCCTGCACCTCAGCCTGG - Intronic
1060884478 9:127140854-127140876 CCTGCCTCTGCAGCACAGCCAGG - Intronic
1061525379 9:131157354-131157376 CCTGCTTGGGCAACACAGCAAGG - Intronic
1061578980 9:131525189-131525211 CCTGATCGTGCAGCACATCCAGG - Exonic
1061961287 9:133990579-133990601 CCTGCCCGAGCAAGTCAGCCTGG + Intronic
1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG + Intergenic
1062423450 9:136495069-136495091 GATGCTCCAGCAACACAGCCTGG - Exonic
1187633591 X:21202569-21202591 CATGGTGGTGCAACACAGCACGG - Intergenic
1189893260 X:45627869-45627891 CCTGCTCGTCCAGCACAGTAAGG + Intergenic
1190785422 X:53643377-53643399 CTTGCTCTTGTCACACAGCCTGG + Intronic
1191225202 X:58035186-58035208 CCTGCTTGTGCCAGACAGACTGG - Intergenic
1195381979 X:104279758-104279780 CTTGCTCGTGTCACACAGCCTGG + Intergenic
1200118649 X:153780412-153780434 CCTGCTCCTGCGACGCTGCCTGG - Intronic
1200780115 Y:7207064-7207086 CCTGCTACTGCAATCCAGCCTGG + Intergenic