ID: 1026467830

View in Genome Browser
Species Human (GRCh38)
Location 7:70669704-70669726
Sequence ACGATGACTTCAACTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026467830 Original CRISPR ACGATGACTTCAACTCTCAA AGG (reversed) Intronic
902111210 1:14079996-14080018 ATGATCCCATCAACTCTCAAAGG + Intergenic
907610852 1:55869341-55869363 ACCATGAGATCAGCTCTCAATGG - Intergenic
1064263465 10:13805075-13805097 AATATAACTTCAAATCTCAAAGG + Intronic
1068357866 10:55934404-55934426 ACCATGGCTTCAATTCTAAATGG - Intergenic
1071035779 10:81243254-81243276 ACAATAACTTCAAGTGTCAATGG + Intergenic
1079264149 11:18913864-18913886 AGGATGAGTGCAACTCTCTAGGG + Intergenic
1079321150 11:19452557-19452579 AGGATGTTTTCAACTCACAATGG - Intronic
1083316466 11:61817384-61817406 AAGATAACTGCAACTTTCAAGGG - Intronic
1090763938 11:129860792-129860814 GCTGTGACTTCAACTCTGAAAGG - Intergenic
1092737852 12:11600302-11600324 AAAATGACTTCAATTCCCAAAGG - Intergenic
1093621664 12:21297708-21297730 GCTATGACTTCAGCTTTCAAGGG - Intronic
1098770387 12:74545050-74545072 GTGATGACATCAACTCTGAAAGG + Exonic
1099801260 12:87459960-87459982 ACAATGACATCAAATCTCATGGG + Intergenic
1101799442 12:108007982-108008004 AGGATGGCTTCAACTGGCAAGGG - Intergenic
1107685521 13:42893834-42893856 ATAATGTCTTCAACTCACAATGG + Intronic
1114152968 14:20065223-20065245 ACAATGACTTCAACAGTCACAGG + Intergenic
1119258813 14:73224470-73224492 ATGATGCCTCCAATTCTCAAAGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1125333398 15:38604089-38604111 AAAAGGACTTCAACTCTCTAGGG - Intergenic
1127230960 15:56994345-56994367 AGGAAGATTTCAACTCACAATGG + Intronic
1134237147 16:12475521-12475543 ACGATATTTTCAACTCACAATGG - Intronic
1136299829 16:29326616-29326638 ACGATGACCTCTACTTTAAATGG - Intergenic
1142061562 16:88033378-88033400 ACGATGACCTCTACTTTAAATGG - Intronic
1142794037 17:2293016-2293038 ACACTAACTTCAACCCTCAAAGG + Intronic
1143734056 17:8897983-8898005 ACTATGCCTTAAACTCTCAGGGG - Intronic
1146403514 17:32518845-32518867 ATAACGACTTCAACTCTCAGAGG + Intronic
1148488844 17:48010150-48010172 AACATGACTTCTGCTCTCAAAGG - Intergenic
1150637092 17:66920978-66921000 TCGATGACTTCATCTCTTACTGG - Intergenic
1152685129 17:81690161-81690183 ACTATGGCTTCATCTCTCCAGGG + Exonic
1155293931 18:24368575-24368597 TCGATGTCTTCACCTCTAAAGGG + Intronic
1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG + Intergenic
1164493709 19:28737971-28737993 ACGATGACCACAACTCACACAGG + Intergenic
927076084 2:19579355-19579377 ATCATGTCTGCAACTCTCAAAGG - Intergenic
928129304 2:28638105-28638127 AAGATGACTGCTACTCTCATGGG + Intronic
930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG + Intergenic
930131757 2:47859116-47859138 ACATTTACTTCAACTCTTAATGG + Intronic
933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG + Intergenic
938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG + Intergenic
941223893 2:162820520-162820542 ACAATGACCTCAACATTCAAGGG + Intronic
942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG + Intergenic
942578854 2:177394706-177394728 ACGGTGACTGAAACTCTCAGAGG - Intronic
945018818 2:205550235-205550257 ACGCTGTCTTCAACTCTCCCAGG + Intronic
945918152 2:215726303-215726325 CCACTGAATTCAACTCTCAATGG + Intergenic
946803438 2:223445605-223445627 CCATTGACTTCAAATCTCAAGGG + Intergenic
947682111 2:232044322-232044344 ACTGTGACTTCATCTCTCACTGG - Intronic
1170855239 20:20047040-20047062 AAGAGGACACCAACTCTCAAAGG + Intronic
1173076324 20:39823260-39823282 ATGAGGACTTCAACTATGAAAGG + Intergenic
1174773231 20:53320871-53320893 ACGATGTCTTCATCACTCAGAGG - Intronic
1176623674 21:9074427-9074449 AGGCTGAATTCAACTCTCCAGGG - Intergenic
1177808036 21:25894493-25894515 ACAATGATTCCAACTCTCATGGG + Intronic
1179130810 21:38635746-38635768 ACCATGACCTCAAATGTCAATGG - Intronic
962883148 3:139598259-139598281 ACACAGACTTCACCTCTCAATGG - Intronic
963369519 3:144380569-144380591 ACCATGACTTCAACTTATAAAGG - Intergenic
963642265 3:147875498-147875520 ATGGTGACTTCAACACTTAAGGG + Intergenic
964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG + Intergenic
967194284 3:187013080-187013102 ACGAAGACTTCAATTCATAATGG + Intronic
970390308 4:15603043-15603065 AAGTTGATTCCAACTCTCAATGG - Intergenic
975035152 4:69670211-69670233 ACTCTTACTTCAACTTTCAAAGG - Intergenic
990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG + Intergenic
995280085 5:110324532-110324554 AAGATGCCTTCAACTATGAAAGG - Intronic
998296434 5:140974074-140974096 ACCATGACTTCAAAAATCAAAGG + Intronic
998932129 5:147193057-147193079 AAAATGTCATCAACTCTCAATGG - Intergenic
1011985570 6:93439784-93439806 ACACTGACTCCATCTCTCAATGG - Intergenic
1023004087 7:35844152-35844174 ATGATTACTTCTACCCTCAAAGG + Intronic
1025017420 7:55450152-55450174 TCGGTGACTCCAACTCCCAAGGG - Intronic
1025219651 7:57095546-57095568 ATGATTACTTCTACCCTCAAAGG - Intergenic
1025630439 7:63267097-63267119 ATGATTACTTCTACCCTCAAAGG - Intergenic
1026312738 7:69201802-69201824 GCAATGACTTCAACTATCAGTGG - Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1031445653 7:121850333-121850355 AATCTGACTTCCACTCTCAAAGG + Intergenic
1038933175 8:32217983-32218005 ACTCTGACTTCAACACTCACAGG - Intronic
1041532267 8:58882319-58882341 ACGATGACTTTATCTTTCATTGG + Intronic
1045429399 8:102098890-102098912 ACACTGACTTCATCTCTCACTGG + Intronic
1046390060 8:113559233-113559255 AAGATGACTTCATCTCTCACAGG + Intergenic
1049911697 9:275268-275290 AAGGTGACTTCAGCTCTGAAGGG + Intronic
1053408869 9:37902889-37902911 AGGGTGACTCCAATTCTCAAAGG + Intronic
1054858933 9:69930096-69930118 ACGATGCCTTCAACTCACTCAGG + Intergenic
1059725505 9:117004577-117004599 AGGATTTCTTCACCTCTCAATGG - Intronic
1187814018 X:23211445-23211467 ATGACGGCCTCAACTCTCAAGGG + Intergenic
1197593065 X:128432674-128432696 AGGATGACTTCATATTTCAAGGG + Intergenic
1202037990 Y:20654749-20654771 TCCATGACTACAACTCACAAGGG + Intergenic