ID: 1026469614

View in Genome Browser
Species Human (GRCh38)
Location 7:70684021-70684043
Sequence TTGGGGAATCATACACTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026469614 Original CRISPR TTGGGGAATCATACACTTGC TGG (reversed) Intronic
906559137 1:46742157-46742179 CTGGCCAATCATACAATTGCTGG - Intergenic
907029269 1:51154620-51154642 TTGTGCATTCATACACTTGAGGG - Intergenic
911590210 1:99738494-99738516 TTTGGAAAACATACACTTGTTGG + Intronic
920248972 1:204609710-204609732 TGCGGGAATCATACAGCTGCAGG - Intergenic
920348113 1:205319685-205319707 TTGGGCAATCATGTACTTCCTGG - Intronic
922560924 1:226569013-226569035 TTGGGGAAGCATGCACGTGTGGG - Intronic
924831470 1:247600099-247600121 TTGGGGATCCATAAAATTGCAGG + Intergenic
1063577498 10:7275043-7275065 TTAGGGAAGCATACACAGGCTGG + Intronic
1064918849 10:20493261-20493283 TTGCTGAATCATGTACTTGCCGG + Intergenic
1070331247 10:75418800-75418822 TAGGGGTAGGATACACTTGCAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1084748611 11:71189204-71189226 TGGGGGAATCACACACCTGCTGG - Intronic
1088035798 11:105313372-105313394 TTTGGGAATTATACAATGGCTGG + Intergenic
1088830641 11:113533395-113533417 TTGGGGAAATACACACATGCAGG + Intergenic
1094784973 12:33837805-33837827 TTGGAGAATCTGACACTTACAGG - Intergenic
1099167091 12:79320171-79320193 TTAGGGAATCATACATTTTTTGG - Intronic
1103497294 12:121372890-121372912 GTGTGGATTGATACACTTGCAGG + Intronic
1104290280 12:127460175-127460197 CTGGGGAATCATACTTTTGGGGG + Intergenic
1110362847 13:74647079-74647101 TAGGAGAAAGATACACTTGCAGG - Intergenic
1111764211 13:92506995-92507017 TTAGGGAATCACATACTTGGGGG - Intronic
1113579099 13:111416191-111416213 TTGTGAAATCATACACTTAAAGG + Intergenic
1114870479 14:26649750-26649772 TTGGAGCATCATAAACTTGGAGG + Intergenic
1126883950 15:53129795-53129817 TTGGGGAATGTTACCCCTGCAGG - Intergenic
1127431607 15:58915472-58915494 TTGCTTAATCATACACTTACTGG + Intronic
1127918254 15:63472956-63472978 TTGGGGAATCAGACACTGAGGGG - Intergenic
1132556541 16:575187-575209 TGGGGGTGTCATCCACTTGCTGG + Intronic
1138215382 16:55200092-55200114 TTGGGAACTAATACACTTCCAGG - Intergenic
1140783813 16:78320505-78320527 TTGGGGAATAATGCTCTTACGGG - Intronic
1146696199 17:34910539-34910561 TTGGGGAATCCTAAACCTCCAGG + Intergenic
1148189427 17:45668225-45668247 ATGGGGAATGTTACACTTACAGG + Intergenic
1152460439 17:80439446-80439468 TTGGGGGAGCCCACACTTGCTGG + Intergenic
1156093639 18:33502197-33502219 TTGGGGTATCATTTACTTACAGG + Intergenic
1161525538 19:4752695-4752717 TTGGGAAATATTACACTTGTGGG + Intergenic
1161887381 19:7007411-7007433 TGGGGGACGCATGCACTTGCCGG + Intergenic
1161887828 19:7010493-7010515 TGGGGGACGCATGCACTTGCCGG - Intergenic
926806850 2:16719042-16719064 TTGGGGACTCATAGACTTTTTGG + Intergenic
929662629 2:43803805-43803827 TTGGGGAACAATACAGTTGTTGG + Intronic
929742324 2:44615616-44615638 TTGGGGAATATTACATTTGAGGG + Intronic
931089412 2:58869383-58869405 TTTGGGAAGCAGTCACTTGCTGG + Intergenic
931090298 2:58878563-58878585 TTGGGGAATCATAGACTAATTGG + Intergenic
932402645 2:71492212-71492234 CTGGGGAATCAGATACTGGCCGG + Intronic
933586658 2:84186672-84186694 CTGGGGTATCCTACAATTGCTGG + Intergenic
938043100 2:128092142-128092164 TTCAAGAATCTTACACTTGCAGG + Intronic
939582950 2:143972935-143972957 TTTAGCAATCATTCACTTGCTGG + Intronic
948964291 2:241364337-241364359 TTGGGGGAGAATACACTTACAGG - Intronic
1171084010 20:22219293-22219315 TTGAGGCATCATAGATTTGCAGG - Intergenic
1181805796 22:25373790-25373812 TCGGGAAATCACACACTTTCAGG - Intronic
1183602763 22:38849707-38849729 TTGGGGAATCATTCAGATGAAGG + Intergenic
1184548540 22:45190737-45190759 TTTGGGAATCTTACACTGGGAGG - Intronic
1185112146 22:48906041-48906063 CTGGGGAGTCATCCACCTGCAGG + Intergenic
952528370 3:34237726-34237748 TTGGAAAAGCATAGACTTGCTGG - Intergenic
953251740 3:41250136-41250158 TTGCAGAATCATACACTCTCAGG + Intronic
964917859 3:161857755-161857777 TTGGGGAATAGTCCACTGGCAGG + Intergenic
965604548 3:170485458-170485480 TTGTGGAACCACACACTTCCTGG + Intronic
969116478 4:4873431-4873453 TTGGGGAACCTTGCATTTGCTGG - Intergenic
977212427 4:94234749-94234771 TAGGGGAATCATTTAATTGCAGG + Intronic
978882154 4:113718547-113718569 TTTGGGAGTCATACAGTTGGAGG - Intronic
980492465 4:133545698-133545720 TTGGGGGAATATACACTTTCAGG + Intergenic
981406681 4:144378784-144378806 GTGGGCAATCACACACTTGAAGG - Intergenic
994123464 5:96143948-96143970 TTAGGCAATCAGACACTTGAGGG + Intergenic
1000457893 5:161474679-161474701 TTGGGAAATCATTCATTTTCAGG + Intronic
1003288381 6:4755406-4755428 TTGGGGAATCACACAATTAGGGG - Intronic
1004151271 6:13122295-13122317 TTGGGGAATCAATCAGTAGCAGG - Intronic
1009988646 6:70813252-70813274 TTGGAGAAGCAAACCCTTGCTGG - Intronic
1013815041 6:114087498-114087520 TTGGGGATTCATAGACGTACAGG - Intronic
1017456622 6:154606687-154606709 TTGGGGAACCACCCATTTGCTGG + Intergenic
1018745023 6:166755102-166755124 CTGAGGAATCATACATTTGTTGG - Intronic
1019780997 7:2939655-2939677 TTGGGGACTCACACCCTGGCAGG + Intronic
1026469614 7:70684021-70684043 TTGGGGAATCATACACTTGCTGG - Intronic
1033130546 7:138741970-138741992 TTGGGGAAGAAGACATTTGCAGG + Intronic
1033388252 7:140900464-140900486 TTGGGAAAGGATACACTTGCTGG - Intronic
1041014794 8:53582105-53582127 TTGGGGAAAAACACACTTTCTGG - Intergenic
1045592684 8:103615818-103615840 TTGGGGAATCAATTACTTCCTGG - Intronic
1048649071 8:136454145-136454167 TTTGGGAAGCCTACACTAGCGGG + Intergenic
1188342364 X:29019718-29019740 TTGGGGAGCCATTCACTTTCTGG - Intronic
1195981629 X:110584417-110584439 GAGGGGAATCAGACACTGGCAGG + Intergenic