ID: 1026470791

View in Genome Browser
Species Human (GRCh38)
Location 7:70693248-70693270
Sequence CAGTGCCCCCAGAGGGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 352}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026470791_1026470796 -9 Left 1026470791 7:70693248-70693270 CCCCACACCCTCTGGGGGCACTG 0: 1
1: 0
2: 5
3: 37
4: 352
Right 1026470796 7:70693262-70693284 GGGGCACTGCACTGTGCTCTAGG 0: 1
1: 0
2: 2
3: 34
4: 383
1026470791_1026470797 -8 Left 1026470791 7:70693248-70693270 CCCCACACCCTCTGGGGGCACTG 0: 1
1: 0
2: 5
3: 37
4: 352
Right 1026470797 7:70693263-70693285 GGGCACTGCACTGTGCTCTAGGG 0: 1
1: 0
2: 2
3: 13
4: 199
1026470791_1026470798 -7 Left 1026470791 7:70693248-70693270 CCCCACACCCTCTGGGGGCACTG 0: 1
1: 0
2: 5
3: 37
4: 352
Right 1026470798 7:70693264-70693286 GGCACTGCACTGTGCTCTAGGGG No data
1026470791_1026470799 16 Left 1026470791 7:70693248-70693270 CCCCACACCCTCTGGGGGCACTG 0: 1
1: 0
2: 5
3: 37
4: 352
Right 1026470799 7:70693287-70693309 ATACAGACACGATACATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026470791 Original CRISPR CAGTGCCCCCAGAGGGTGTG GGG (reversed) Intronic
900413071 1:2521866-2521888 CAGGACACCCAGAGAGTGTGGGG - Intronic
900585349 1:3429969-3429991 CAGTGCCCCCGGGCGGAGTGAGG + Intronic
901519914 1:9775569-9775591 CAGGGCCCCCAGTGTGCGTGTGG - Intronic
901670339 1:10852254-10852276 CAGGGCTCCCAGAGGAGGTGGGG + Intergenic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
903796098 1:25929929-25929951 CACTGCACCCAGCTGGTGTGAGG - Intergenic
903971951 1:27124719-27124741 CACTGCCCTCAGATGCTGTGAGG - Intronic
903986611 1:27233963-27233985 GAGGGCACCCAGAGTGTGTGTGG + Intergenic
905293453 1:36939203-36939225 ATGTGCCCCCAGAGGGAGCGGGG + Intronic
905732529 1:40306504-40306526 CAGTACCCCCACAGGGAGGGAGG + Intronic
905923812 1:41736081-41736103 CAGTGCCCGCCCAGGGTGTCTGG + Intronic
906052650 1:42887707-42887729 CAGAGCCCCAGGAGCGTGTGCGG - Intergenic
906647079 1:47482999-47483021 CTGTGGCCCCAGAGAGTGGGAGG + Intergenic
907750400 1:57257728-57257750 CAGAGCCCCCAGAGGGAGTATGG - Intronic
907902607 1:58754825-58754847 CAGTACCCCAAAAGGGTGTTTGG + Intergenic
910088128 1:83428560-83428582 CAAAGCCCCCAGTGGGTGAGAGG + Intergenic
913339869 1:117747733-117747755 CACTTCCTTCAGAGGGTGTGTGG + Intergenic
914858724 1:151370002-151370024 CAGGGCCCCGGGAGGGTGGGAGG + Intronic
915561171 1:156689161-156689183 AACTGCCACCAGAGGGAGTGAGG + Intergenic
915782202 1:158564634-158564656 AAGAGCCTCCAGAGGGAGTGCGG + Intergenic
916263594 1:162868494-162868516 CACTTCCTCCAGAGGGTCTGTGG - Intronic
917522924 1:175762953-175762975 CAGTGCCTTCAGAGGGAGCGTGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918083396 1:181224532-181224554 TAGAGCCTCCAGAGGGAGTGTGG + Intergenic
918247421 1:182672094-182672116 CTCTGCACCCAGAGGCTGTGCGG + Intronic
921670683 1:217920711-217920733 TAGAGCCTTCAGAGGGTGTGTGG + Intergenic
922245787 1:223796079-223796101 CATTGTCCCCAGAGGATGTGGGG - Exonic
922354993 1:224766982-224767004 AAGTGCCCCAAGAGGCTGAGTGG + Intergenic
922550953 1:226493960-226493982 CAGTGTCTCCAGAGGGAGTCAGG - Intergenic
923680363 1:236113781-236113803 CAGGGCCTCCAGAGGGTGCACGG - Intergenic
924691421 1:246355442-246355464 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
924821764 1:247498899-247498921 CAGTCCCACCAGAGGGTGATGGG + Intergenic
1062946290 10:1464539-1464561 GACTGCCCCCAGCGCGTGTGTGG - Intronic
1062946304 10:1464605-1464627 GACTGCCCCCAGCGCGTGTGTGG - Intronic
1062946318 10:1464671-1464693 GACTGCCCCCAGCGCGTGTGTGG - Intronic
1062946332 10:1464737-1464759 GACTGCCCCCAGCGCGTGTGTGG - Intronic
1062946346 10:1464803-1464825 GACTGCCCCCAGTGCGTGTGTGG - Intronic
1064565275 10:16633192-16633214 AAGTGTCCCCAGCGGGAGTGGGG + Intronic
1067227268 10:44384383-44384405 AAGAGCCCCGCGAGGGTGTGGGG + Intronic
1069045476 10:63738651-63738673 CAGTGGCCCCCCAGAGTGTGAGG + Intergenic
1069717791 10:70532094-70532116 CAGTTCCCTCAGTGGGTCTGTGG + Intronic
1069842028 10:71345905-71345927 CAGCCCGCCCAGAGGATGTGGGG + Intronic
1072440535 10:95450373-95450395 CAGTCCCCACAGTGGGTATGTGG - Intronic
1074530849 10:114297710-114297732 CAGTGACCCAAAAGGGTGAGGGG + Intronic
1074881946 10:117666479-117666501 CAGGGACAGCAGAGGGTGTGTGG + Intergenic
1075073065 10:119331598-119331620 CAGGGCCCCTTTAGGGTGTGAGG + Intronic
1075388984 10:122078571-122078593 CAGTGCCCCCAGAGGGTGAAAGG + Intronic
1075418887 10:122286210-122286232 CAGCTCCCTCAGGGGGTGTGTGG - Exonic
1075618959 10:123911735-123911757 CAGAGCCCACAGAGGCTCTGTGG - Intronic
1076001065 10:126913418-126913440 CAGTGCCCCCTGGAGTTGTGTGG - Intronic
1076428831 10:130387583-130387605 CAATGCCTTCAGAGGGTGCGTGG + Intergenic
1076529301 10:131133894-131133916 CAGAGGCCCCAGTGGGTGTTGGG - Intronic
1077169289 11:1159178-1159200 CACTGGGGCCAGAGGGTGTGAGG + Intronic
1077227344 11:1444225-1444247 GAGTGCCCCCAGCAGCTGTGGGG + Intronic
1077300676 11:1845714-1845736 AAGGTGCCCCAGAGGGTGTGGGG + Intergenic
1077392225 11:2305372-2305394 CCCCCCCCCCAGAGGGTGTGTGG + Intronic
1077465741 11:2732916-2732938 CTGGGCCTCCAGAGGGTGGGTGG - Intronic
1078734413 11:14006985-14007007 TAGAGCCCCCAGAGGGAGTGTGG - Intronic
1083199274 11:61110044-61110066 TAGAGCCCCCAGAGGGGGTCAGG + Intronic
1083292834 11:61699400-61699422 TAGTGCCACCTGTGGGTGTGGGG - Intronic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1083689170 11:64396364-64396386 CTGTGCCCCCAGAGGGCCAGGGG + Intergenic
1083797053 11:65022999-65023021 GAGTGCAGCCAGAGGGTGGGAGG + Intronic
1084196136 11:67524307-67524329 GAGTGCCCTCAGAGGGGCTGGGG + Intergenic
1084581968 11:70029752-70029774 CAGGGCCTCTAGAGGGAGTGTGG - Intergenic
1085203275 11:74714540-74714562 CAGTGACCCCAGAAGGCGTAGGG - Intronic
1085530757 11:77190670-77190692 AAGTGCCCCAAGAGGGTTTGTGG - Intronic
1086490508 11:87354030-87354052 CATTCCCCCCAGAGCATGTGTGG - Intergenic
1088323922 11:108582730-108582752 TAGTGCCCCCAGAGGGAGCATGG - Intronic
1089002471 11:115063607-115063629 CACTGCCCTCAGAGGCAGTGTGG + Intergenic
1089440035 11:118507575-118507597 CAGTCCTCCCAGAAGGAGTGTGG + Exonic
1090324031 11:125869598-125869620 CAGGCCCCCTAAAGGGTGTGGGG - Intergenic
1090657233 11:128855441-128855463 CCTGGCACCCAGAGGGTGTGAGG + Intronic
1090804433 11:130194135-130194157 CTCTGCCCCCACAGGTTGTGTGG + Exonic
1091283172 11:134393866-134393888 CAGTGCCCCCAAAGAGAGGGAGG + Intronic
1091468755 12:708646-708668 CAGTGAGCCAAGATGGTGTGGGG - Intergenic
1092076160 12:5675363-5675385 CTCTGCCCCCAGAGAGTTTGAGG - Intronic
1092089798 12:5795083-5795105 CACTGCCACCAGAGACTGTGTGG - Intronic
1092899065 12:13041467-13041489 CAGTGACCTCAGTGGGTGTTTGG + Intergenic
1092899235 12:13043331-13043353 CAGTGACCTCAGTGGGTGTTTGG + Intergenic
1092899431 12:13044600-13044622 CTGTGCCACCAGAGGGCGAGAGG + Intronic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1093280908 12:17195263-17195285 CAGGGTCCCCTGAGGGTTTGGGG + Intergenic
1095214849 12:39536321-39536343 CAGTGCCACCAGAGTTTCTGTGG - Intergenic
1096788146 12:54029488-54029510 CTGTACCCCCAGTGGGGGTGGGG + Intronic
1096869379 12:54583875-54583897 CACAGCCCCCAGAGGGGGAGGGG - Intronic
1097702243 12:62831983-62832005 CAGTGTCCCCAGAGTTAGTGGGG - Intronic
1099240344 12:80130979-80131001 CATTCCCCCCAAAGGGTTTGGGG + Intergenic
1101642914 12:106601385-106601407 CAGTTCCCCCTGAGGGTGCCAGG - Intronic
1101717095 12:107320534-107320556 GCGTGCCCCCCGAGGGAGTGGGG - Intronic
1102484784 12:113248233-113248255 AAGTGCCCCACGGGGGTGTGTGG + Intronic
1102551754 12:113696445-113696467 CAGTCCCACCTGAGGGGGTGAGG - Intergenic
1102559753 12:113753815-113753837 CAGTGCCCCCAGAGAGCAAGGGG + Intergenic
1102868591 12:116394245-116394267 CAGAGCCTCCAGAGGCAGTGTGG - Intergenic
1103909639 12:124345160-124345182 CAGTCCCCCCAGGGAGCGTGGGG - Intronic
1103941060 12:124501474-124501496 CAGAGCCCCCAGAGGCCGTGGGG - Intronic
1104927625 12:132321887-132321909 CACTGCCTTCAGAGGGAGTGTGG - Intronic
1107756135 13:43623609-43623631 CACTTCCTTCAGAGGGTGTGTGG + Intronic
1109629932 13:65033010-65033032 CAGTCCCCAGATAGGGTGTGTGG + Intergenic
1109851846 13:68075750-68075772 CAGTGCCAGTAGAGGGTGAGAGG - Intergenic
1111101702 13:83596649-83596671 CTGTGCTCCCAGAGTGTGTTTGG + Intergenic
1113004092 13:105679155-105679177 TGGTGCCCCCAGAGAGGGTGAGG + Intergenic
1113138635 13:107121933-107121955 CAGTGCTCCCACCGAGTGTGTGG - Intergenic
1113325564 13:109278018-109278040 AAGTGGCCCCAGTGGGTTTGGGG - Intergenic
1113397461 13:109961990-109962012 CACTGCCCCCAGGAGGGGTGTGG - Intergenic
1113475255 13:110576030-110576052 CAGGTCCCCCAGAGCGGGTGGGG - Intergenic
1113676839 13:112213669-112213691 CACTGCCCCCTGCAGGTGTGGGG + Intergenic
1113890213 13:113731630-113731652 CAGGGCCCTCAGAGGCTGAGTGG - Intronic
1114541240 14:23461093-23461115 TAGAGCCTCCAGAGGGAGTGTGG + Intergenic
1114727330 14:24953061-24953083 TAGTGCCTCCAGATGGAGTGTGG - Intronic
1115792827 14:36898751-36898773 CAGAGCTGCCAGTGGGTGTGGGG + Intronic
1117279462 14:54223575-54223597 CAGTGCCCTAGGAGGGTATGTGG - Intergenic
1118597368 14:67446301-67446323 GAGTGCCCCCAGAGATTGTTAGG + Intergenic
1121459716 14:94065615-94065637 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
1122422479 14:101586427-101586449 AGGTGCCCCCAGAGGGTCTCTGG - Intergenic
1122624768 14:103078909-103078931 CAGTGCAGCCAGAGGATGTGAGG + Intergenic
1122794873 14:104201108-104201130 CAGTGCACCCAGTGGGTGGGAGG + Intergenic
1122922871 14:104887163-104887185 CTGTGCCCGCAGAGGCTGGGGGG - Exonic
1123586000 15:21761162-21761184 CTTTGCCCCCAGAGAGTTTGAGG + Intergenic
1123622641 15:22203752-22203774 CTTTGCCCCCAGAGAGTTTGAGG + Intergenic
1124322341 15:28724475-28724497 CAGTGCTCTCAGAGGCTGAGGGG + Intronic
1124523431 15:30426280-30426302 CAGTGCTCTCAGAGGCTGAGGGG + Intergenic
1124535235 15:30539934-30539956 CAGTGCTCTCAGAGGCTGAGGGG - Intergenic
1124763419 15:32467662-32467684 CAGTGCTCTCAGAGGCTGAGGGG + Intergenic
1124775207 15:32581385-32581407 CAGTGCTCTCAGAGGCTGAGGGG - Intergenic
1125510906 15:40291812-40291834 AGGTGCCCCCAGTAGGTGTGCGG + Intronic
1126073585 15:44886984-44887006 CTGTGCCACCACAGGATGTGGGG - Intergenic
1126339139 15:47620345-47620367 CCCTGCCTCCAGAGGGTGTGAGG - Intronic
1127031010 15:54863194-54863216 CACTGCCTTCAGAGGGTCTGTGG - Intergenic
1127959884 15:63882819-63882841 CAGTGACCCCAGGCAGTGTGGGG + Intergenic
1128629832 15:69253324-69253346 CAGTGTTCCCACAGGGTGAGTGG - Intronic
1128662572 15:69513089-69513111 GAGAGCCCCAAGTGGGTGTGGGG + Intergenic
1129112098 15:73343327-73343349 CACTCCCCACAGAGGGAGTGAGG - Intronic
1129407185 15:75327587-75327609 TAGTGCCCCCAGCTGCTGTGCGG + Intergenic
1129532829 15:76282361-76282383 TAGAGCCCCCAGAGGGAGTATGG + Intronic
1129608389 15:77035756-77035778 CAGTGTCCCCAGAAGGGGAGGGG + Intronic
1129775781 15:78235412-78235434 CACAGCCCCCAGAGGGAGTGTGG - Intronic
1129868052 15:78924061-78924083 CAGAGCCCCCAGGAGGTGGGGGG + Intronic
1131629200 15:94157986-94158008 TAGAGCTCCCAGATGGTGTGGGG - Intergenic
1132334666 15:101038492-101038514 CAGGGCCCACAAAGGGTGAGGGG + Intronic
1133330035 16:4967185-4967207 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1134609587 16:15597824-15597846 CAGTGCCCCCCTAGGGTTGGTGG - Intronic
1134634984 16:15785389-15785411 CAATGGCCCCAGAGGCTGTGTGG - Intronic
1135328306 16:21541899-21541921 CAGGGCCCCCAGAGGAAGTCAGG + Intergenic
1136271899 16:29153533-29153555 CAGAGCCCCCGGAGGGAGTACGG - Intergenic
1136271912 16:29153567-29153589 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271923 16:29153601-29153623 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271934 16:29153635-29153657 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271944 16:29153669-29153691 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271977 16:29153771-29153793 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1137248192 16:46722353-46722375 CTGTCCCCCCAGAGGGTGTGAGG + Intronic
1137466961 16:48718497-48718519 CAGTGCCCTGAGAGGGAGTCAGG - Intergenic
1137984825 16:53099032-53099054 CACTACCCACAGAGGGTGGGTGG + Intronic
1138661054 16:58517214-58517236 CAGTGAGCCCAGACTGTGTGTGG + Intronic
1139036227 16:62949927-62949949 CAGAGCCTCCAGAGAGTGAGAGG - Intergenic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1139960570 16:70715138-70715160 CAGGTTGCCCAGAGGGTGTGGGG + Intronic
1140181402 16:72722681-72722703 CAGTGCACCCAGTGGGGGGGAGG + Intergenic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1140469060 16:75204661-75204683 CTGGGCCCCAGGAGGGTGTGGGG + Intronic
1140880136 16:79190506-79190528 CAGTGGAGCCAGAGGGTGTGAGG - Intronic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1141711977 16:85705034-85705056 CAGTGCTCGCAGAGGCCGTGTGG - Intronic
1142075552 16:88115655-88115677 CAGAGCCTCCAGAGGGAGTACGG - Intronic
1142075574 16:88115723-88115745 CAGAGCCCCCAGAAGGAGTACGG - Intronic
1142404983 16:89883496-89883518 CAGTGCCCTCAGAGCAGGTGGGG + Exonic
1142955865 17:3521312-3521334 CACTGCCCCCAGCAAGTGTGAGG - Intronic
1144517682 17:15930107-15930129 CAGAGCCCCTGCAGGGTGTGGGG - Intergenic
1146486646 17:33248616-33248638 TGGAGCCTCCAGAGGGTGTGTGG - Intronic
1147757393 17:42778067-42778089 CTGAGCCCCCACAGGGGGTGAGG + Intronic
1147790938 17:43014018-43014040 CAGTGCCCCATGGGGGTATGAGG - Intronic
1149419611 17:56496473-56496495 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1151756888 17:76080247-76080269 CAGTCCACCCAGAGCCTGTGGGG - Exonic
1152016825 17:77756311-77756333 CAGGGCCTCCAAAGGGAGTGAGG + Intergenic
1152107205 17:78337586-78337608 CATGGCCCCCAGAGGGTGACCGG - Intergenic
1152438274 17:80289133-80289155 CAGTGCCCCCAGGAGGAGTTGGG + Intronic
1152497320 17:80682630-80682652 CAGGGCCTCCAGAGGGAGCGTGG + Intronic
1152531144 17:80919964-80919986 CTGGGCCCACAGAGGCTGTGCGG + Intronic
1152659094 17:81534262-81534284 CAGAGCCCCCACAGGGCCTGAGG - Intronic
1153201750 18:2655120-2655142 CAGGGCCCCCAGAGGGTGCGGGG + Intergenic
1154299229 18:13178417-13178439 CTGGGACCCCAGAGGGTGCGAGG - Intergenic
1159485801 18:69055658-69055680 CTGTGCCCCAAGTGGGTGTGGGG + Intergenic
1161317156 19:3622640-3622662 CTCGGCCCCCAGAGGGAGTGGGG + Intronic
1161868688 19:6853879-6853901 TTGTGCCCCCAGAGAGTGAGTGG + Intronic
1162380446 19:10328778-10328800 CAGTGCACGTAGAGGGTGCGTGG + Exonic
1162926149 19:13931438-13931460 CAGAGCCCCCAAAGGGTGCCTGG + Intronic
1163400300 19:17088119-17088141 TAGAGCCTCCAGAGGGAGTGTGG - Intronic
1163411019 19:17154536-17154558 CAGTGCCGCCATAGGGAGTGTGG + Intronic
1163831748 19:19550429-19550451 CAGGGCCCCGAGAGAGTGGGAGG - Intergenic
1164611293 19:29634098-29634120 CAGTCCACCCACAGGGTATGAGG - Intergenic
1164748796 19:30635950-30635972 GGGTGCCCCCAGAGGATGAGTGG + Intronic
1165152473 19:33769153-33769175 CACTGCCCTCCGAGGCTGTGGGG + Intronic
1165188489 19:34042107-34042129 CAGTGCCCCCTGCTGGTGAGTGG - Intergenic
1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG + Intronic
1165781110 19:38434744-38434766 CAGTGGCTCCGCAGGGTGTGGGG + Intronic
1165855361 19:38876692-38876714 AAGTCCCCACAGAGGGGGTGAGG - Exonic
1166368056 19:42287117-42287139 CACCACCCCCAAAGGGTGTGGGG - Exonic
1167180741 19:47901535-47901557 CAGAGCCTCCAGAGGGAATGTGG + Intergenic
1168682726 19:58327528-58327550 CAGTGGCCTGGGAGGGTGTGGGG + Intronic
1168695297 19:58400812-58400834 CAGGGCCCCCTGAGGGTGGCGGG - Intergenic
925169161 2:1740472-1740494 CAGAGCCCCCAGAGGGCCTGGGG + Intronic
925178060 2:1798677-1798699 CCATGCTCCCTGAGGGTGTGCGG + Intronic
925652378 2:6104657-6104679 CAGTTCCCTCAAAGGGTATGTGG + Intergenic
925795721 2:7540012-7540034 CAGTTCCCGCAAAGGGTCTGTGG + Intergenic
926121091 2:10241480-10241502 CCCTGCCCCCGGTGGGTGTGAGG - Intergenic
927433196 2:23044264-23044286 TAGAGCCCCCAGAAGGAGTGTGG + Intergenic
928118219 2:28563354-28563376 GAGGGACCCCAGAGGGAGTGTGG + Intronic
928138472 2:28706952-28706974 CACTCCCCCCAGAGGCTCTGGGG - Intergenic
928605134 2:32938544-32938566 CAGTGGCCCTAGGGGGAGTGAGG - Intergenic
928805152 2:35141037-35141059 CAGTCCCCCCAGAGCTTTTGGGG + Intergenic
929775552 2:44929004-44929026 CGGTGCCCCGTGCGGGTGTGGGG - Intergenic
929816548 2:45237483-45237505 CAGTGAACCCACAGGATGTGGGG + Intergenic
932416911 2:71579092-71579114 CTGTGGCCACAGGGGGTGTGGGG - Intronic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
933678543 2:85078631-85078653 CAGGGTCCCCACAGAGTGTGAGG + Intergenic
933774210 2:85761997-85762019 CAGCACCCCCAGAGGGTGGAGGG + Intronic
933848887 2:86349685-86349707 CTATGCCCAAAGAGGGTGTGTGG - Intergenic
934517037 2:94994720-94994742 CAGAGGCCCCTGAGGGTGGGGGG - Intergenic
934610279 2:95730372-95730394 CAAGGGCCCCAGAGGGTCTGGGG + Intergenic
934938803 2:98484480-98484502 CAGGGCCCTGAGAGGGTGTGAGG + Intronic
935614202 2:105059827-105059849 CATTGGCCCCAGAACGTGTGTGG - Intronic
936521775 2:113216067-113216089 GAGTGTCCCCAGAGGGGCTGTGG + Exonic
936543607 2:113371958-113371980 AAGGGCCCCCAGAGGGTCTGGGG + Intergenic
937116227 2:119406905-119406927 CACTGCAGCCAGAGGCTGTGTGG + Intergenic
937262472 2:120595389-120595411 CTGTGCTCCCTGGGGGTGTGGGG + Intergenic
938405378 2:131029988-131030010 CTGTGACACCAGATGGTGTGAGG + Intronic
938745382 2:134273115-134273137 CATTTCCCCCAGAAGGTGGGGGG + Intronic
939013690 2:136876901-136876923 CAGAGACCCCAGAGCGTGTTAGG - Intronic
939998901 2:148947739-148947761 CAGTGCCTCCAGACAGGGTGTGG - Intronic
940987335 2:160062525-160062547 CAAGGCCCCCGGAGGGGGTGGGG - Exonic
942113722 2:172707183-172707205 CACTGCTACCACAGGGTGTGGGG + Intergenic
943621284 2:190150587-190150609 CACTTCCTTCAGAGGGTGTGTGG + Intronic
943952164 2:194144917-194144939 CTGTTCCCCCACATGGTGTGTGG - Intergenic
944900397 2:204207978-204208000 CTGTTCACCCAAAGGGTGTGTGG - Intergenic
946058596 2:216921702-216921724 CATAGCCACCAGAGTGTGTGGGG + Intergenic
947541610 2:230983763-230983785 TAGAGCCTCCAGAGGGAGTGTGG - Intergenic
948658004 2:239488701-239488723 CTGTGACCCCAGAGAGTGAGCGG - Intergenic
1169340104 20:4790087-4790109 CTGTGCCCCCAGCTGGTGTATGG - Intronic
1170654695 20:18275704-18275726 CAGTTCAGCCAGAGGGTGAGTGG + Intergenic
1170740993 20:19056545-19056567 CAGTGCCATCAAAGGGTCTGTGG - Intergenic
1171337868 20:24402490-24402512 CAGTTCCCACAAAGGGTGAGTGG - Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173019983 20:39259048-39259070 AAGTGCATGCAGAGGGTGTGGGG - Intergenic
1173247914 20:41348875-41348897 CAGAGCCCCCAGGGTGTGTAAGG + Exonic
1173470818 20:43322019-43322041 CAGTGCCCTGAGAGGGAGGGTGG + Intergenic
1175285635 20:57834897-57834919 CAGAGCCTCCAGAGGGAGTACGG - Intergenic
1178123929 21:29497295-29497317 TAGAGCCCTCAGAGGGAGTGTGG - Intronic
1178313030 21:31545310-31545332 TAGGGCCCTCAGAGGGAGTGTGG + Intronic
1178355362 21:31906778-31906800 CCGTGGGCTCAGAGGGTGTGTGG + Intronic
1178374302 21:32054371-32054393 CAGAGCCCTCAGAGGAAGTGTGG - Intergenic
1178788689 21:35677812-35677834 CAGAGTCCCCTGAGGGAGTGAGG + Intronic
1181342802 22:22196139-22196161 CAGGGACCCCAGAGGGTCTTTGG - Intergenic
1181359529 22:22323771-22323793 CAGTCCCCCCAGATGGTGGAGGG + Intergenic
1181369609 22:22405515-22405537 CAGTCCCCCCAGATGGTGGAGGG + Intergenic
1182409077 22:30167070-30167092 TAGAGCCCCCAGAGGGAGTGTGG - Intronic
1183384214 22:37505758-37505780 CAGGGCCCAGAGAGGGTGAGGGG - Intronic
1184408486 22:44313411-44313433 GAGAGCCCACAGAGGGTGTGTGG + Intergenic
1184676667 22:46046700-46046722 AAGGTCCCCCAGAGGGTTTGGGG - Intergenic
1184782514 22:46656282-46656304 CAGCACCCCCAGTGGGAGTGGGG + Intronic
1184889701 22:47372213-47372235 CAGTAAACCCTGAGGGTGTGTGG - Intergenic
1185088887 22:48755141-48755163 CAGTGCCCCCACAGAATGTAAGG + Intronic
949362176 3:3243622-3243644 CATAGCCTCCAGAGGGAGTGTGG + Intergenic
950158052 3:10738787-10738809 CAGCGCCCCCAGAGGTGGTCGGG + Intergenic
950603683 3:14058504-14058526 CACTTCCTCCAGAGGGTCTGTGG + Intronic
952108283 3:30093539-30093561 CACGGCCCCCAGAGAGTGAGTGG + Intergenic
952820519 3:37482070-37482092 CAGTGCAGCCAGAAGCTGTGTGG - Intronic
952821754 3:37492052-37492074 AACTGCCCCCAAAGTGTGTGTGG + Intronic
953410687 3:42688944-42688966 CAGTGGCCCCAAAGAGTGAGCGG - Exonic
953435162 3:42872068-42872090 CAGTGCTACAAGAGGGTGAGGGG - Intronic
953664913 3:44918502-44918524 TAGTGGCCTCAGAGGATGTGTGG - Intronic
953724091 3:45382272-45382294 CACTTCCCTCAGAGGGTCTGTGG + Intergenic
953878636 3:46680369-46680391 CAGTGCCCCCAGCGGGAGTGGGG + Intronic
955393069 3:58535291-58535313 CAGTGTCCACAGGGGGAGTGGGG - Intronic
955937319 3:64113766-64113788 GAGTGATCCCTGAGGGTGTGGGG - Intronic
957717422 3:83946752-83946774 TAGTGCCTCCAGAGGGAGTGTGG + Intergenic
957870838 3:86089242-86089264 CAGTGCCTCCAGACTCTGTGTGG + Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960516418 3:118607595-118607617 CACTTCCTTCAGAGGGTGTGTGG - Intergenic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961048633 3:123727277-123727299 CAGACCACCCAGAAGGTGTGGGG + Intronic
961112041 3:124292540-124292562 CAGAGCCCTGAGAGGGTGTCTGG + Intronic
963373933 3:144438398-144438420 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
966220216 3:177544273-177544295 CAGTGCCCTCAGAGTCAGTGTGG + Intergenic
966229974 3:177641070-177641092 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
966770214 3:183497522-183497544 CCCTGCACCCAGAGGGGGTGAGG + Intronic
968472287 4:787663-787685 CAGAGCCTCCAGAGGGAGTGTGG + Intronic
969115861 4:4870418-4870440 CAGTCCCCCGAGGGTGTGTGTGG + Intergenic
969538739 4:7772741-7772763 CAGTGCACCCAGAGAGAATGTGG - Intronic
969572391 4:8017055-8017077 GAGTGACCCTAGATGGTGTGTGG + Intronic
972169942 4:36333762-36333784 CCGTGCCCACAGAAGGAGTGTGG + Intronic
973296334 4:48525427-48525449 CAGTGCCCCCTGCAGATGTGAGG - Intronic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
978106148 4:104904267-104904289 AGGAGCCACCAGAGGGTGTGTGG + Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
981670372 4:147279623-147279645 CTTTGGCCCCAGATGGTGTGGGG - Intergenic
981778511 4:148397945-148397967 CAGAGCCTTCAGAGGGAGTGTGG - Intronic
982206985 4:153004282-153004304 CACTTCCCCCAGAGTGTGTGGGG + Intergenic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
982606999 4:157527839-157527861 AGGTGTCTCCAGAGGGTGTGTGG + Intergenic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
985730806 5:1547467-1547489 CAGTGACACCGTAGGGTGTGGGG + Intergenic
986199957 5:5571173-5571195 CTGAGGCCCCAGAGGGTTTGTGG - Intergenic
986216492 5:5724368-5724390 CAGCGGCCCCAGAGGCTGTAAGG - Intergenic
986238746 5:5937811-5937833 CAGAACCCCCAGAAGGTGTCGGG - Intergenic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
992708291 5:79421238-79421260 AAGTGCCCCCAGATGCTGTAAGG + Intronic
993920566 5:93795447-93795469 CAGTTCCTTCAGAGGGTCTGTGG + Intronic
994002082 5:94792276-94792298 CAGTACTCACAGAGCGTGTGTGG - Intronic
994084288 5:95741681-95741703 CAGTACGCCCAGTGGGTTTGGGG + Intronic
997377072 5:133404940-133404962 CAGTGCCCCAAGTGGCAGTGAGG + Intronic
997709656 5:135993191-135993213 AAGTGCCCCCTGAGTGTGTGTGG - Intergenic
997798393 5:136834433-136834455 CAGTTCCCTCAAAGGGTCTGCGG + Intergenic
997963411 5:138338829-138338851 CAGTCTCCCCAGGAGGTGTGGGG + Intronic
998471947 5:142390342-142390364 CAGAGCCCCCAGAGGAAGTGAGG - Intergenic
999959119 5:156735375-156735397 CAGAGCTCCCAGAGGCAGTGGGG - Intronic
1001123637 5:168999641-168999663 CAGTGTCCCTATAGGGTGAGAGG + Intronic
1001255099 5:170177225-170177247 CAGCGGCCCCCCAGGGTGTGCGG - Intergenic
1002185347 5:177452026-177452048 CCGTGCTCCCAGTGAGTGTGTGG + Intronic
1006299199 6:33184952-33184974 CACTGCCCCCAGATGGGGTGAGG + Intronic
1007357052 6:41328713-41328735 CAGTGGCCCTAGAGGGTCTTGGG + Intergenic
1007985053 6:46199041-46199063 CATGGGCCCCAGAGGGAGTGCGG + Intergenic
1009243022 6:61202649-61202671 AATTGCCTCCAGAGGGTGTATGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1012234278 6:96795119-96795141 CTGGGCCTCCAGAGGGTCTGTGG - Exonic
1014635598 6:123843084-123843106 CTGGAGCCCCAGAGGGTGTGTGG + Intronic
1017042355 6:150317602-150317624 CAGTTGCCCCAGGGGGTGGGGGG + Intergenic
1018961624 6:168453241-168453263 CTGTGCCCCAAGAGGGTGTGGGG + Intronic
1019471923 7:1225579-1225601 CAGAGTCCCCAGAGGGTGAGCGG - Intergenic
1019530918 7:1502983-1503005 CAGGGCACTCAGAGGGGGTGTGG + Exonic
1020081947 7:5291015-5291037 CGCTGCCCACAGAGGGTGAGTGG - Intronic
1020421972 7:8016964-8016986 AAGTGACCCCAGAGCATGTGAGG + Intronic
1022517484 7:30985113-30985135 CAGAGACCCCAGAGGGCGGGTGG - Intronic
1023402125 7:39798067-39798089 CACTACCCCCAAAGTGTGTGGGG + Intergenic
1023560699 7:41470518-41470540 CATTGTCCCCAGAGGTTCTGTGG - Intergenic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1024944572 7:54795754-54795776 CAGTGCCCCCAGCTGGTAAGTGG + Intergenic
1025110708 7:56213808-56213830 CAGTAGCTCCAGAGGCTGTGTGG + Intergenic
1025196970 7:56941123-56941145 CGCTGCCCACAGAGGGTGAGTGG + Intergenic
1025674978 7:63635814-63635836 CGCTGCCCACAGAGGGTGAGTGG - Intergenic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1027298988 7:76809992-76810014 CATTGCCTCCAGAGGGTGCCTGG + Intergenic
1027305001 7:76884997-76885019 CAAAGCCCCCAGTGGGTGAGAGG + Intergenic
1027721153 7:81743370-81743392 CAGTACTCCCAGCGGGTGTGAGG + Exonic
1027960446 7:84939712-84939734 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033657244 7:143382127-143382149 CAGGGGTCCCAGAGCGTGTGGGG - Intronic
1034254807 7:149719074-149719096 CAGAGCCTTCAGAGGGAGTGTGG - Intronic
1037731083 8:21524462-21524484 TGGTGCCCTCAGAGGGAGTGTGG - Intergenic
1037755844 8:21709683-21709705 CAGTACCTGCAGAGAGTGTGTGG - Intronic
1038908699 8:31937512-31937534 CAGTTCCCTCAAAGGGTCTGTGG - Intronic
1040887959 8:52285649-52285671 CAGAGCCCCCAGAGGGACTCAGG + Intronic
1041005204 8:53491453-53491475 CAGAGCCCCCAGAGGGAGTATGG - Intergenic
1041748905 8:61237842-61237864 CAGGGAGCCCAGAGGATGTGTGG + Intronic
1043833547 8:85018130-85018152 CAGTGCCCCCCGAGGTTCTCAGG + Intergenic
1043876489 8:85492000-85492022 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
1045244619 8:100432109-100432131 CAGTGCCTCCAGTGTGTGTTAGG - Intergenic
1046086703 8:109445515-109445537 CAGTGGTCCCAGCGGGAGTGCGG - Exonic
1047763324 8:127970205-127970227 GTGTGCCCCCTGAGGGTCTGAGG - Intergenic
1048357710 8:133667177-133667199 CAATGTCCCCAGAGGGACTGAGG - Intergenic
1048444311 8:134481842-134481864 CATTGGCCACAGAGGGTCTGTGG + Intronic
1049176749 8:141197454-141197476 CCGAGCCCTCAGAGGGGGTGTGG + Intergenic
1049230607 8:141479422-141479444 CAGGACCCCCAGAGGGGGTTGGG + Intergenic
1049354402 8:142180373-142180395 CAGGGCCCCCAGAGAGTACGGGG - Intergenic
1049591323 8:143464328-143464350 CACTGCCCCCACAGGGTCTGGGG + Intronic
1052894457 9:33734522-33734544 CACTTCCCTCAGAGGGTCTGTGG - Intergenic
1053289849 9:36872765-36872787 CTGTGCCCTCATAGGGTGGGGGG - Intronic
1056268091 9:84919844-84919866 CAGTGCCTCATGAGGTTGTGAGG + Intronic
1057047768 9:91899162-91899184 AAGGGCCCCCAGGGGGTGCGGGG + Intronic
1057047930 9:91900203-91900225 CAGGGCCGCCAGGGGGTGGGGGG + Intronic
1057119644 9:92559500-92559522 CATTTCCCTCAGAGGGTCTGTGG + Intronic
1058767850 9:108199076-108199098 CACTGCCACCCGAGGCTGTGAGG - Intergenic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1059663066 9:116420477-116420499 CAGGGCCCACAGAGGGTGAACGG + Intergenic
1059878712 9:118665849-118665871 CAGTGCAGTCAGAGGATGTGGGG + Intergenic
1060958899 9:127664949-127664971 CAGGGCCCCCAGTGGAAGTGCGG + Intronic
1061091239 9:128427840-128427862 GAGGAGCCCCAGAGGGTGTGAGG + Intronic
1061601234 9:131671515-131671537 CAGTGCCCCCAGAACCTCTGTGG - Intronic
1061823049 9:133239138-133239160 CCGTGCCCCCAGAGGGCTTTGGG - Intergenic
1061848276 9:133400326-133400348 CAGGGCCCCCAGAGGCTGGTAGG - Intronic
1061937478 9:133866146-133866168 CAGGCCCCCCAGGGGGTGGGTGG + Intronic
1062210264 9:135359820-135359842 CAGAGCCTCCCGAGGGGGTGTGG + Intergenic
1062475542 9:136725019-136725041 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1185520415 X:734481-734503 CAGGGTCCCCAGAGAGAGTGGGG + Intergenic
1185683506 X:1908401-1908423 TAGAGCCTCCGGAGGGTGTGTGG - Intergenic
1186308342 X:8289725-8289747 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1187005038 X:15224469-15224491 CAGTGTCCACAGAGGGACTGTGG + Intergenic
1187117662 X:16369844-16369866 TAGAGCCCTCAGAGGGAGTGTGG - Intergenic
1188584448 X:31756142-31756164 ATGAGCCCCCAGAGGGTGGGAGG - Intronic
1189567136 X:42254749-42254771 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1192410736 X:70930465-70930487 CAGACCCCCCAGAGGGAGAGGGG + Intronic
1192860030 X:75057884-75057906 CAGTGGCACAAGAGGGTCTGTGG + Intronic
1195706184 X:107739498-107739520 CAGTTTCCCCAGCGTGTGTGTGG - Intronic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1200111694 X:153743913-153743935 CAGCGCCCCCAGGGAGTGGGAGG - Exonic