ID: 1026470999

View in Genome Browser
Species Human (GRCh38)
Location 7:70694221-70694243
Sequence TCCGGCCCGCGCTCGGCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026470999_1026471010 22 Left 1026470999 7:70694221-70694243 CCGCAAGCCGAGCGCGGGCCGGA No data
Right 1026471010 7:70694266-70694288 ACCCGCCAGCCCGCAAGCTCCGG No data
1026470999_1026471002 -6 Left 1026470999 7:70694221-70694243 CCGCAAGCCGAGCGCGGGCCGGA No data
Right 1026471002 7:70694238-70694260 GCCGGAGCCCAGCCAGCCCCGGG 0: 1
1: 0
2: 3
3: 59
4: 470
1026470999_1026471014 29 Left 1026470999 7:70694221-70694243 CCGCAAGCCGAGCGCGGGCCGGA No data
Right 1026471014 7:70694273-70694295 AGCCCGCAAGCTCCGGCCAGAGG No data
1026470999_1026471001 -7 Left 1026470999 7:70694221-70694243 CCGCAAGCCGAGCGCGGGCCGGA No data
Right 1026471001 7:70694237-70694259 GGCCGGAGCCCAGCCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026470999 Original CRISPR TCCGGCCCGCGCTCGGCTTG CGG (reversed) Intronic