ID: 1026471948

View in Genome Browser
Species Human (GRCh38)
Location 7:70701226-70701248
Sequence TCTCACAAGCTGATTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026471945_1026471948 -3 Left 1026471945 7:70701206-70701228 CCGTGGGAGGGCAGTGCTAATCT 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1026471948 7:70701226-70701248 TCTCACAAGCTGATTGTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 134
1026471942_1026471948 10 Left 1026471942 7:70701193-70701215 CCATAAAATTTCACCGTGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1026471948 7:70701226-70701248 TCTCACAAGCTGATTGTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026471948 Original CRISPR TCTCACAAGCTGATTGTGGT GGG Intronic
903112231 1:21145940-21145962 TTTAATTAGCTGATTGTGGTGGG + Intronic
904420558 1:30388325-30388347 TTTCACAAGCTAATGTTGGTTGG - Intergenic
904920625 1:34005177-34005199 TCTCCCTAGCTGAATGTGCTTGG - Intronic
905172740 1:36118685-36118707 TCTCAGAAGCTGGTTGGGGGTGG - Intronic
908383640 1:63619853-63619875 TCTCACATTCTGAGTGGGGTTGG - Intronic
914955297 1:152156574-152156596 TCTCTCAGGCTGACTGTGGTGGG + Exonic
914955311 1:152156682-152156704 TCTCTCAGGCTGACTGTGGTGGG + Exonic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
916550399 1:165844557-165844579 TCTAACAAGATAACTGTGGTGGG + Intronic
921358897 1:214312521-214312543 TCTGACAGGGTGATTGTGGCAGG + Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
924300157 1:242629202-242629224 TCTCTCCAGATGATTGTGCTTGG + Intergenic
1063040222 10:2330131-2330153 TCTCATAAGCTCGTTCTGGTTGG - Intergenic
1069780499 10:70952486-70952508 TCTCCCAGGCTGATGGGGGTTGG + Intergenic
1072630730 10:97144721-97144743 TCTCACAAGTTGGTTTTGGCTGG - Intronic
1073351915 10:102825921-102825943 TCTCCCAGGCTGCTTGTGATGGG - Intergenic
1077182458 11:1222855-1222877 TCTCAGAAGCTGCTGGGGGTGGG + Intergenic
1077934360 11:6768212-6768234 TCTTCCCACCTGATTGTGGTCGG - Exonic
1078402182 11:11038144-11038166 TCTGACAAGCTGATAGTGCCTGG - Intergenic
1085899233 11:80678074-80678096 TCTGGCAAGGTGATTGTCGTTGG - Intergenic
1088984208 11:114891147-114891169 ACACACAAGATGCTTGTGGTGGG + Intergenic
1089393388 11:118117297-118117319 TCTCACAGGGTGACAGTGGTGGG + Exonic
1091535469 12:1404464-1404486 TCTCACAAGCAAAGTGTGCTGGG + Intronic
1093390773 12:18617866-18617888 TCTGACAGGCTGATTATAGTAGG + Intronic
1095681095 12:44977070-44977092 TCTCTCAAGATGACTGTGTTAGG + Intergenic
1097051938 12:56229000-56229022 TCTCAGAGGCTAATTGTGGGAGG - Exonic
1098451818 12:70627629-70627651 TGTCACAGGCTGAATATGGTTGG + Intronic
1099094017 12:78350629-78350651 TCTCACATGCTGAAAGTGCTTGG + Intergenic
1101769035 12:107731309-107731331 TCTCAAAATGTGATTGTAGTTGG - Intergenic
1103302543 12:119939049-119939071 TCCCACAAACAGATGGTGGTGGG - Intergenic
1106129842 13:26931215-26931237 TCTTACAGGATTATTGTGGTAGG - Intergenic
1106432937 13:29698968-29698990 TCTCAAATGCTGGTTGTGGTAGG - Intergenic
1107374009 13:39782647-39782669 GAGCACAAGCTGATTGTGTTTGG + Intronic
1110385467 13:74905828-74905850 CCACACAAGCTGATTGTGTGGGG + Intergenic
1111386609 13:87536685-87536707 TCTCAGAAGCGGGATGTGGTAGG + Intergenic
1111732644 13:92096409-92096431 TCTCCCAAGCTATTTGTGATTGG + Intronic
1112193258 13:97199008-97199030 TCTTACAAACTGCTTGTGGAAGG + Intergenic
1116868244 14:50048633-50048655 TCTCCCAGGCTGATTCTGGGAGG + Intergenic
1119205007 14:72787699-72787721 ACTAATAAGCTGTTTGTGGTGGG + Intronic
1119851899 14:77872328-77872350 TCACACAAGCTGCTTCTGGGAGG + Intronic
1123918740 15:25055919-25055941 CCTCACGTGCTGGTTGTGGTTGG + Intergenic
1124052649 15:26212409-26212431 ATTCACAAGCTGATTGTCCTGGG - Intergenic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1126345422 15:47688857-47688879 TTTCACAAGCATATTTTGGTTGG + Intronic
1126355555 15:47791878-47791900 TCTCACAAGCAAAGTGTGCTTGG + Intergenic
1127220004 15:56869917-56869939 TCTCACAAGCTGATGTGGGAAGG + Intronic
1135531257 16:23256712-23256734 TCTCATAAGGTGATGGTGGAAGG - Intergenic
1135604969 16:23816107-23816129 TCTTACAAACTAAATGTGGTTGG - Intergenic
1138649526 16:58451448-58451470 GCTCACAAGGTGGTTCTGGTGGG + Intergenic
1143942466 17:10556839-10556861 TGTCACAAGCTGAGTGGGCTTGG - Intergenic
1144286735 17:13784545-13784567 TATAATAAGCTGATTGTGGTTGG + Intergenic
1145112805 17:20179082-20179104 CCACAGAAGCTGATTTTGGTTGG + Intronic
1150177661 17:63078123-63078145 TCTCAGAAGCTAATTGGGCTTGG + Intronic
1152046618 17:77940851-77940873 TCTCACAGCCTCATTGTGGGAGG + Intergenic
1153617640 18:6949183-6949205 TCTCCCATGGTGACTGTGGTGGG - Exonic
1155398677 18:25415207-25415229 TGTCAACAGCTGAGTGTGGTGGG + Intergenic
1156413028 18:36854028-36854050 TCTCAGAAGGTGATTGTGTTTGG + Intronic
1156576481 18:38322758-38322780 TCTTGCAAGCTGGTGGTGGTGGG + Intergenic
1156973469 18:43186682-43186704 TCTAAAAAGCCTATTGTGGTAGG - Intergenic
1157141459 18:45111414-45111436 TCTCTCTAGCTGATTGTTTTTGG - Intergenic
1159857123 18:73602241-73602263 ACTCACAAGCTTCTAGTGGTGGG + Intergenic
1163622480 19:18369210-18369232 TGTCACAAGCTGAGTGGGGGGGG + Exonic
1164597708 19:29541046-29541068 TCACAGAAGCTTACTGTGGTGGG + Intronic
1165240612 19:34463860-34463882 TCTCAGAATCTGATTGTATTTGG - Intronic
925381829 2:3433531-3433553 ACTCACTAGCTGTTTGTGCTGGG - Intronic
926449600 2:12986313-12986335 TCCCACATGCTGGTTGTGATAGG + Intergenic
928416449 2:31096276-31096298 TCTCAGAAACTGAATATGGTAGG - Intronic
933281186 2:80334347-80334369 TCTCAAAAGCTGATTGTTCAAGG - Intronic
933565615 2:83946907-83946929 TCTGATAAACTGATTGAGGTAGG - Intergenic
935008241 2:99103412-99103434 TCTCCCAAGCTTATTGCTGTAGG + Intronic
937341976 2:121096947-121096969 ACCCACAGGGTGATTGTGGTAGG + Intergenic
938409051 2:131048761-131048783 TCTCTAAAGCAGAGTGTGGTTGG - Exonic
938920836 2:135993167-135993189 TCTCAGAAGGTGACTGTGTTTGG + Intergenic
941163681 2:162062934-162062956 ACAGACAAGGTGATTGTGGTAGG - Intronic
943218327 2:185069226-185069248 TCTCACATGCTTGTTGTGTTGGG - Intergenic
944931348 2:204523148-204523170 TCTCAGAAGCTGGGTGTGGGTGG - Intergenic
945805647 2:214486936-214486958 TCTCAGAATGTGATTGTGTTTGG + Intronic
1169169559 20:3453619-3453641 TCTCGCTAGTTCATTGTGGTAGG - Intergenic
1174937922 20:54892893-54892915 GCTCAGAAGCTGATTGAGGTTGG - Intergenic
1177005685 21:15669483-15669505 TCTCACAAACAGATTGCAGTTGG - Intergenic
1177668919 21:24200009-24200031 TCTCAGAATCTGACTGTGTTTGG + Intergenic
1179771829 21:43625483-43625505 TTCCACAACCTAATTGTGGTGGG + Intronic
1184908415 22:47508673-47508695 TTTCATAAACTCATTGTGGTTGG + Intergenic
950697390 3:14713776-14713798 TCTCACAACCACCTTGTGGTAGG - Intronic
953610271 3:44442007-44442029 TCTCACAGGGTGATTGTGGGTGG - Exonic
953744567 3:45564492-45564514 CCTCATAAGATGATGGTGGTTGG - Intronic
957302461 3:78410191-78410213 TCTTACAAGCTGATCGCTGTGGG + Intergenic
959062976 3:101632760-101632782 ACTCAGAAGTTGATTTTGGTGGG - Intergenic
959147382 3:102565363-102565385 TCTCACAATGTGATTGTATTTGG - Intergenic
959700456 3:109293724-109293746 TGTTACAAACTGACTGTGGTTGG - Intergenic
960376397 3:116907029-116907051 TCTCAGAAGCTGAATGAGTTTGG - Intronic
961611581 3:128143914-128143936 TTTCACAAGATCATTGTGGTCGG - Intronic
963694399 3:148546989-148547011 TCTAAGAAGATGATTGGGGTTGG + Intergenic
965329559 3:167353810-167353832 TCATACAAGCTAATAGTGGTGGG + Intronic
967084474 3:186081258-186081280 TCTAACTAGCTGATTGTTCTTGG + Intronic
967484579 3:190015647-190015669 TTTCCCAAGCTGATATTGGTAGG + Intronic
967679234 3:192340309-192340331 GCTTACAATCTGGTTGTGGTTGG - Intronic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
970243584 4:14035074-14035096 TCCCAGGAGCTGCTTGTGGTTGG + Intergenic
970529112 4:16964246-16964268 TCTCAAAAGGTGATTATGTTTGG + Intergenic
974304618 4:60117631-60117653 TCTTACAAGGTGATGGTAGTAGG - Intergenic
976885711 4:89981094-89981116 TCTCAGAATGTGATTGTGTTAGG + Intergenic
978330651 4:107609509-107609531 TGTCACACTCTGTTTGTGGTTGG + Intronic
980087731 4:128409303-128409325 TCTCAAATGCTGGTTGTGCTAGG + Intergenic
983061997 4:163171468-163171490 TCTTACAAGCTGAGTGTGAGAGG - Intergenic
984311509 4:178066645-178066667 TCTCAGAAGCTGTTTGTACTAGG + Intergenic
986495569 5:8338492-8338514 TTTCACAAGGTGGTGGTGGTGGG - Intergenic
987616800 5:20284481-20284503 ACTCACAAGTGGATTATGGTAGG - Intronic
988554450 5:32224055-32224077 TCTCCCCAGCTGATGGGGGTGGG - Intergenic
988711499 5:33781447-33781469 TCTCACAAGCTCCTTGAGGATGG + Intronic
999168551 5:149572778-149572800 TCTGCCAAACTGATTGTGTTTGG + Intronic
1000730106 5:164824319-164824341 ACTCACAATCTGCTAGTGGTTGG + Intergenic
1002869471 6:1153805-1153827 TCTCAGAAGCTTTTTGTGCTTGG + Intergenic
1006686425 6:35838369-35838391 CCTCGCAAGCTCATTGTGGCAGG - Exonic
1009969641 6:70613327-70613349 TCTGACTAGCTGAGGGTGGTAGG + Intergenic
1011324307 6:86132301-86132323 GCTCTCAAGTTGATTGTTGTAGG + Intergenic
1014119088 6:117702382-117702404 TCTCTCCAGTTGATTGGGGTGGG + Intronic
1015852397 6:137588040-137588062 TCTCAAAAGTAGATTGTCGTTGG + Intergenic
1017347989 6:153406719-153406741 TCTCACAAGCTGAATTATGTGGG + Intergenic
1019946958 7:4337630-4337652 TCTCAGAATGTGATTGTGTTTGG - Intergenic
1021549648 7:21856407-21856429 TCTAACAAGCACAGTGTGGTTGG + Intronic
1022144562 7:27524169-27524191 TTTCACAGGCTGCTTGTGATAGG + Intergenic
1022941152 7:35240873-35240895 ACTCACCAGTTGATTCTGGTAGG + Exonic
1023629780 7:42152646-42152668 TCTCTCAGGCTGATTGTGATAGG - Intronic
1025617269 7:63131585-63131607 TATAACAAGCTTATTGTAGTGGG + Intergenic
1026471948 7:70701226-70701248 TCTCACAAGCTGATTGTGGTGGG + Intronic
1028342059 7:89733992-89734014 CCTCCCAAGCTCATTGTGGGTGG - Intergenic
1028866556 7:95720295-95720317 TCTCAGAAGGTCACTGTGGTTGG + Intergenic
1032271548 7:130412663-130412685 TCTCACCAGCTGTTTGAGCTGGG - Intronic
1041756501 8:61319170-61319192 TGTCATAAGCTCATTGTGGTGGG + Intronic
1042185709 8:66134757-66134779 TCTAACAACCTGCTTGGGGTAGG - Intronic
1043134346 8:76502412-76502434 TGTCTCAAGCTGAATGTGCTAGG + Intergenic
1043916213 8:85925501-85925523 TCCTACAAGCTGAGTGTTGTTGG + Intergenic
1048662610 8:136622592-136622614 TCCCACATGCTCATTGTGGCTGG + Intergenic
1053608402 9:39683218-39683240 TTTCAGAAACTAATTGTGGTAGG + Intergenic
1053866244 9:42439582-42439604 TTTCAGAAACTAATTGTGGTAGG + Intergenic
1054245128 9:62659191-62659213 TTTCAGAAACTAATTGTGGTAGG - Intergenic
1054559256 9:66693722-66693744 TTTCAGAAACTAATTGTGGTAGG - Intergenic
1057449285 9:95142477-95142499 TCTCAGAAGCTGAGGGGGGTTGG - Intronic
1057691902 9:97293081-97293103 TCTCACAGGCAGATTGCGTTGGG - Intergenic
1059971725 9:119675417-119675439 TCTGACAAGCTGCTTGACGTTGG + Intergenic
1186549546 X:10488410-10488432 TCTCACAAACTGCTGGAGGTGGG - Intronic
1186853812 X:13606757-13606779 TATCTCAAGATGATTCTGGTGGG + Intronic
1190309960 X:49110194-49110216 TCTCCCAGGCTGATTGTGCAGGG - Intergenic
1192814495 X:74576822-74576844 TCTCACAAGCTGAGTTTCTTAGG + Intergenic
1196403427 X:115339666-115339688 TCTCAAAATTTGATTGTGGTGGG + Intergenic
1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG + Intergenic