ID: 1026473179

View in Genome Browser
Species Human (GRCh38)
Location 7:70711600-70711622
Sequence GATTTGCTCTGACATGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026473179_1026473184 27 Left 1026473179 7:70711600-70711622 CCTGGTTCATGTCAGAGCAAATC 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1026473184 7:70711650-70711672 GAGAATGACAGCTTTGGAAATGG No data
1026473179_1026473181 -10 Left 1026473179 7:70711600-70711622 CCTGGTTCATGTCAGAGCAAATC 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1026473181 7:70711613-70711635 AGAGCAAATCTTTGAACAGTGGG 0: 1
1: 0
2: 0
3: 24
4: 185
1026473179_1026473182 21 Left 1026473179 7:70711600-70711622 CCTGGTTCATGTCAGAGCAAATC 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1026473182 7:70711644-70711666 ACACCAGAGAATGACAGCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026473179 Original CRISPR GATTTGCTCTGACATGAACC AGG (reversed) Intronic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
903260936 1:22131655-22131677 GATTTGCTGTGTGATGCACCTGG + Intronic
904798392 1:33074851-33074873 GGTTTGCTCTAACATGATCCTGG + Intronic
914444371 1:147737487-147737509 GCATTGCTCTGACACGCACCTGG + Intergenic
915359635 1:155278126-155278148 GATTTCCTCTTTCAGGAACCCGG + Intronic
916171829 1:162007112-162007134 GATCTTCTCTGGTATGAACCAGG - Intronic
921762273 1:218929860-218929882 GATTTGCACTCACATGTGCCTGG + Intergenic
922083143 1:222317738-222317760 GTTTTACTCTGAACTGAACCTGG - Intergenic
1066127903 10:32360601-32360623 GATTTGATCTCACATGTATCAGG + Intronic
1068117207 10:52748299-52748321 GATTTGCTCTCACATCATCAGGG - Intergenic
1069347961 10:67492190-67492212 CATTTACTCTGACAGGAACTGGG + Intronic
1071975040 10:90947111-90947133 GAGCTGCTCTGAAATGAGCCTGG + Intergenic
1085268866 11:75257863-75257885 GATTTGATCTGAGATCAAACAGG - Intergenic
1088286233 11:108191238-108191260 GATGTCCTCTGACATCAACTTGG - Intronic
1090452460 11:126818982-126819004 TATTTGAACTGAAATGAACCTGG + Intronic
1092044920 12:5424616-5424638 GAGGAGCTCAGACATGAACCAGG + Intergenic
1092978616 12:13770847-13770869 GATTCTATCTGACAAGAACCAGG + Intronic
1094067395 12:26376048-26376070 CTTTTGCTCAGACATGATCCTGG - Intronic
1099748290 12:86735864-86735886 GACTTGCTCTAACTTAAACCTGG + Intronic
1100797731 12:98199928-98199950 GATCAGTTCTGAAATGAACCAGG - Intergenic
1102021382 12:109685853-109685875 AATTTGATCTGACTTGATCCAGG + Intergenic
1104486124 12:129152495-129152517 GATTTGACCTGACATGAGCCTGG + Intronic
1105939257 13:25132539-25132561 GTTTTGCTCTGTCCTTAACCTGG - Intergenic
1106784937 13:33097407-33097429 GATTGGCTCTGTCATAAACGCGG + Intergenic
1108649975 13:52468215-52468237 TATTTTCTCTGACATTAACTAGG - Intronic
1111430831 13:88146557-88146579 GATTAGTTCTGTCAGGAACCTGG - Intergenic
1112096812 13:96141980-96142002 GATTGGCTCTGTCATAAATCTGG - Intronic
1113561508 13:111285304-111285326 GATGTGCTATGGAATGAACCAGG - Intronic
1116366866 14:44077473-44077495 GATTTGCTCTTAAATGTTCCAGG + Intergenic
1117125290 14:52616697-52616719 TATTTTCTCTAACAAGAACCTGG - Intronic
1117367471 14:55043671-55043693 GACTGGCTCTGTGATGAACCTGG + Exonic
1118294204 14:64554108-64554130 GATTTGCTCAGACTTTAACAGGG - Intronic
1118656655 14:67957759-67957781 GATTTCTGCTGAAATGAACCAGG - Intronic
1121865921 14:97362683-97362705 CCTTTGCTCTGCCAAGAACCTGG + Intergenic
1122039163 14:98970456-98970478 GATATTCTCTAACTTGAACCAGG + Intergenic
1122460235 14:101888540-101888562 GATCTGCTCTTGCAGGAACCAGG - Intronic
1124901827 15:33830838-33830860 TCTTTGCTCTGACAGGAGCCAGG - Intronic
1127457801 15:59170947-59170969 GTTCTGCTCTCACATGAACATGG - Intronic
1128702696 15:69815745-69815767 GACTTGCTCTGAGAGGGACCTGG + Intergenic
1130984376 15:88835166-88835188 TCTTTTCCCTGACATGAACCAGG + Intronic
1138413388 16:56857126-56857148 GATTTCCTCTGGCTTGTACCAGG - Intergenic
1140981179 16:80111246-80111268 GTTTTGCTCTGAGCTGAATCAGG + Intergenic
1141263605 16:82475760-82475782 GATTTCCTCAGAAATGCACCTGG + Intergenic
1148833050 17:50448462-50448484 GTTTTGCTGTGACAAGAACATGG - Intronic
1150916350 17:69441748-69441770 GATCTCCTCTGACACTAACCTGG + Intronic
1157432944 18:47644552-47644574 TATTTACTCTTACATGAACATGG - Intergenic
1160344095 18:78116447-78116469 GAAGTGCTCTAACATCAACCAGG - Intergenic
1162437080 19:10667577-10667599 TATTTGCTCTGAAATATACCAGG - Intronic
1162863053 19:13522681-13522703 AATTTGCTCTAACATAACCCTGG - Intronic
1163031072 19:14544579-14544601 GTTCTGCTCTTCCATGAACCGGG + Intronic
1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG + Intronic
1165895982 19:39141209-39141231 GATTTGCTCTGAAATAAGCAGGG - Intronic
925165344 2:1712491-1712513 TATGTGATCTGACATGAACCAGG - Intronic
925297865 2:2790100-2790122 GATTTGCTCTGCCCAGAACCTGG + Intergenic
930000508 2:46858437-46858459 GTTTTGCTATGACAAGAACTTGG + Intronic
931004639 2:57834395-57834417 CATTTGTTCAGACATGTACCAGG + Intergenic
933327243 2:80853417-80853439 GAATGCCTCTGAAATGAACCTGG - Intergenic
937378725 2:121356353-121356375 GATTGGCACTGACATGGTCCTGG + Intronic
938641428 2:133284797-133284819 GATTTGCTCAGATGTGAAGCAGG + Intronic
940687017 2:156864531-156864553 GATTTGCTTTGACATTTAGCTGG + Intergenic
942452999 2:176120247-176120269 GCTTTCCTCTGGCCTGAACCTGG + Intergenic
942569531 2:177299487-177299509 TATTTGCATTGACATGAACAGGG - Intronic
944525899 2:200619327-200619349 GCTTTTCTCTGACCTCAACCTGG + Intronic
1168937004 20:1674151-1674173 TAATTGGTCTGACATGAGCCTGG - Intergenic
1169847210 20:10007489-10007511 CAATTGCTCTGACATCAACATGG - Intronic
1170814908 20:19705460-19705482 GATTTGCTTTTTCATGAACCTGG - Intronic
1174185399 20:48702683-48702705 GCTTTGCTCTGCCAGGACCCAGG - Intronic
1177189740 21:17837609-17837631 GTTTGGCTCTGACATGCAGCTGG + Intergenic
1179444541 21:41422013-41422035 GAGTTGCTGTGGCATGCACCCGG - Exonic
1182099283 22:27646409-27646431 GATTTGCCCTAACATCACCCAGG + Intergenic
1183930223 22:41231788-41231810 GATTTGGTCTCACCTGTACCAGG - Intronic
1203295316 22_KI270736v1_random:37432-37454 GAACTTCTCTGCCATGAACCTGG - Intergenic
954680689 3:52344399-52344421 GCTCTGCTCTGGCATGGACCTGG - Intronic
955466992 3:59247730-59247752 GATATGCTCTGCTAAGAACCAGG + Intergenic
959433282 3:106282355-106282377 GATTTGCTCTGAAGTCAGCCTGG + Intergenic
959978642 3:112489667-112489689 AATTTTCTGTGACATCAACCAGG + Intronic
961107674 3:124256123-124256145 GATTTGCTCAGACAGGAACCTGG + Intronic
964810580 3:160659536-160659558 AATTTGCTAACACATGAACCTGG - Intergenic
965891711 3:173522254-173522276 CATTTGCAGTGACATGAACGGGG - Intronic
967794220 3:193581063-193581085 GTTTAGCTCTGACATGAATATGG + Intronic
970096427 4:12468271-12468293 GAAGAGCTCTGACATGAATCTGG - Intergenic
976882284 4:89942106-89942128 CATTTGCTCTGACATGAAAAAGG + Intronic
977990455 4:103434769-103434791 GATTGTCTCTGACATCACCCCGG - Intergenic
979693330 4:123583913-123583935 GATTTGCTTTCACATGGAGCTGG + Intergenic
981487259 4:145300625-145300647 GCCTTGCTCAGTCATGAACCAGG + Intergenic
985351935 4:189073113-189073135 GATTTGCTCTGTAATTGACCTGG - Intergenic
985469859 5:33494-33516 AATTTGATTTGACAGGAACCTGG - Intergenic
986930890 5:12819287-12819309 CATTTTCTCTGACATGAATTTGG - Intergenic
993313228 5:86364288-86364310 GATGTTCTCTGACATGAAAAGGG + Intergenic
993313441 5:86368418-86368440 GATTTACTATTACATGAACTTGG + Intergenic
994376573 5:99021773-99021795 GATTTGCTCCTAGATTAACCAGG - Intergenic
999188398 5:149729989-149730011 GATTCGCTCTGGCAGGAGCCGGG + Intergenic
1001061377 5:168492491-168492513 GATTTGCTAAGACATGCAGCAGG - Intronic
1004633740 6:17446995-17447017 GATTTGGTCATTCATGAACCAGG - Intronic
1005725095 6:28640100-28640122 GAGATGCGCGGACATGAACCGGG - Intergenic
1005855791 6:29862116-29862138 GATTTGCTTGGCCAGGAACCAGG - Intergenic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1008342581 6:50385410-50385432 GTTTTGCTCTGACTTGACTCTGG - Intergenic
1010017891 6:71125432-71125454 GACTAGCTCTGTCATTAACCAGG - Intergenic
1010372682 6:75129950-75129972 GATTTTCTCTGACATGACGTTGG - Intronic
1011968041 6:93184887-93184909 GATTTGTTTTGACAGGTACCTGG + Intergenic
1015096296 6:129417844-129417866 GCTTTGCTCTGAAATCAGCCTGG + Intronic
1020875829 7:13692316-13692338 GGTTTACTCTGACATGAATTTGG + Intergenic
1021171469 7:17402947-17402969 GATTAGCTCTGATATCCACCGGG - Intergenic
1024048938 7:45605957-45605979 GATTTTCTGTGACATGACTCTGG + Intronic
1024234590 7:47388332-47388354 GATTCCCTGAGACATGAACCTGG - Intronic
1026473179 7:70711600-70711622 GATTTGCTCTGACATGAACCAGG - Intronic
1026513869 7:71049847-71049869 GCTTGGCTCTGGCATGGACCTGG - Intergenic
1030133414 7:106222259-106222281 GCTTTGCTCTGTCATGCTCCAGG - Intergenic
1040708721 8:50162159-50162181 GAGCTGCTCTGACAAGAACCAGG - Intronic
1042138894 8:65659646-65659668 GATTAGATCTGACAGGAAGCGGG + Intronic
1042414468 8:68503334-68503356 GATTTGCTTTGACATAATCTGGG + Intronic
1045377555 8:101590364-101590386 TATTTGCTCTGACTTGAAACAGG - Intronic
1048229394 8:132621934-132621956 CATTTGCTCTGTCATGACCATGG - Intronic
1052844482 9:33322919-33322941 GATTTGTTCTGACCTGAAGAGGG - Intronic
1055901504 9:81243874-81243896 CATTTACTCTGTCATGGACCAGG - Intergenic
1058586130 9:106507840-106507862 GAATTGCTTTAACTTGAACCTGG + Intergenic
1061288049 9:129635448-129635470 GCTTTGCCCTGAGATGAGCCGGG + Exonic
1186745436 X:12563326-12563348 GAGTTGCTCTGGGAGGAACCAGG - Intronic
1189224008 X:39397656-39397678 GATTTACTGTGACAAGGACCCGG - Intergenic
1195047551 X:101067763-101067785 GGTTTCCTATGACATGTACCAGG - Intergenic
1195555374 X:106215661-106215683 GATTTGATAAGACATTAACCAGG + Intergenic
1197152891 X:123239317-123239339 GATTAGTTCTGACGAGAACCAGG - Intronic