ID: 1026473533

View in Genome Browser
Species Human (GRCh38)
Location 7:70714674-70714696
Sequence CAGAATGTGGGGCAGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026473533_1026473538 -10 Left 1026473533 7:70714674-70714696 CCTGAAGACTGCCCCACATTCTG 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1026473538 7:70714687-70714709 CCACATTCTGGAAGTCCTTGCGG 0: 1
1: 0
2: 2
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026473533 Original CRISPR CAGAATGTGGGGCAGTCTTC AGG (reversed) Intronic
901421020 1:9151192-9151214 CACAATGTTGAGCAGTCTCCAGG + Intergenic
903021663 1:20399449-20399471 CAGAACCTGGGTCTGTCTTCAGG - Intergenic
903734640 1:25522408-25522430 CAGAGTGTGGGGGAGGATTCTGG - Intergenic
903787535 1:25871436-25871458 CAGAAGGTTTGGGAGTCTTCTGG + Intergenic
904186821 1:28711952-28711974 CTGAATGGGAGGCAGTCTTTTGG - Intronic
905697739 1:39987900-39987922 CAGAATGTGGAACATTCTACAGG - Intergenic
906286630 1:44592030-44592052 AAGATTGTGGGCCAGTCCTCTGG - Intronic
907380928 1:54087819-54087841 CTGAATGTGGGACATTCTACAGG - Intronic
907486091 1:54779305-54779327 CTGAATTTAAGGCAGTCTTCTGG - Intergenic
909701179 1:78525233-78525255 CTGAAGTTAGGGCAGTCTTCTGG - Intronic
910287191 1:85568849-85568871 CCCAGTGTGGGGCAGTGTTCAGG + Intronic
910847538 1:91617759-91617781 CTGTATTTGGGGAAGTCTTCAGG + Intergenic
911064563 1:93776636-93776658 CAGAATGTGGGAAACTCTACAGG - Intronic
911223080 1:95271862-95271884 CAGCATGTGGGACATTCTCCAGG + Intergenic
911333782 1:96556382-96556404 CAGAAGGTAGGGCAGTCATGAGG + Intergenic
911984284 1:104601312-104601334 CAGAATTTGGGCCTGTCCTCGGG + Intergenic
912696124 1:111843434-111843456 TAGAAAGTGGGGCAGGCCTCAGG + Intronic
915523698 1:156463605-156463627 AAGAATGGGGGGCGGCCTTCAGG - Intergenic
915549331 1:156623595-156623617 CAGAATCTGGGGGAGGCTTGGGG + Intronic
915581808 1:156817246-156817268 AAGGATGTGGGTCAGACTTCTGG + Intronic
918033477 1:180841208-180841230 CAGAATGGGAGGAAGACTTCTGG + Intronic
918416483 1:184313795-184313817 AAGAATTTGGGGCAGTCTCATGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
921135125 1:212253225-212253247 CAGAATGTAGGACATTCTACAGG + Intergenic
922552661 1:226507803-226507825 CAGAATGTGGAGCATTCTACTGG - Intergenic
923588558 1:235297800-235297822 CAGAATGTGGGAAATTCTACAGG + Intronic
924277225 1:242401067-242401089 CAGAATTTGGGGAAGTCTCAAGG - Intronic
1064929854 10:20613331-20613353 CAAAGTGTGGGGCAGTCTTGTGG - Intergenic
1066449386 10:35514408-35514430 CCGCAGGTGGGGCAGTCCTCAGG + Intronic
1067038667 10:42936756-42936778 CCGAGTGTGAGGCAGCCTTCGGG - Intergenic
1067466999 10:46508437-46508459 CAGGGTGTGGGGCAGAGTTCAGG + Intergenic
1067620187 10:47876168-47876190 CAGGGTGTGGGGCAGAGTTCAGG - Intergenic
1068862188 10:61858660-61858682 TGGAATGAGAGGCAGTCTTCGGG + Intergenic
1069832115 10:71287796-71287818 CAGAAGGTGGGACAGGGTTCGGG - Intronic
1071202542 10:83235831-83235853 CTGAAGTTGGGGCAGTCTTGAGG + Intergenic
1071291599 10:84193348-84193370 TAGAATGTGCAGCAGTTTTCAGG - Intergenic
1072595956 10:96872091-96872113 CAGACTGTGGGGCAAGCTACAGG - Intronic
1076735835 10:132458579-132458601 GAGCATGGGGGGCAGTGTTCTGG - Intergenic
1077062758 11:625072-625094 CAGAAGGAGGGGCAGTCGTTTGG + Exonic
1078594828 11:12676446-12676468 CAGATTGGGGAACAGTCTTCAGG + Intronic
1079695931 11:23482664-23482686 CAGCATCTGGGGCACTTTTCTGG + Intergenic
1080452866 11:32393150-32393172 CAGAATCTGAGGCAGAATTCTGG + Intronic
1081927215 11:46840906-46840928 CTGAGTTGGGGGCAGTCTTCTGG + Intronic
1083707255 11:64525080-64525102 CAGAAGCGGGGGCAGTCTTGTGG + Intergenic
1083783948 11:64933320-64933342 CAGAGTTTGGGGTAGTCCTCGGG - Intronic
1084305224 11:68278352-68278374 CTGAAGCAGGGGCAGTCTTCTGG - Intergenic
1085569737 11:77548959-77548981 CAGAATTTGATGCAGTCTTTTGG - Intronic
1086900641 11:92363845-92363867 CAGAATGTTGTGGAGTGTTCAGG - Intronic
1087761689 11:102110168-102110190 CAGAATACGGGGCACGCTTCGGG + Intergenic
1089096456 11:115923657-115923679 CATAATGAGGGGCAGTGTGCAGG - Intergenic
1090890005 11:130915339-130915361 CAGGATGTGGGGCAGTCGCCCGG + Exonic
1090962096 11:131566111-131566133 CCGGGTGTGGGGCAGTTTTCTGG - Intronic
1095506488 12:42904490-42904512 ATTAATGTGGGGCAGTCTTGTGG - Intergenic
1095816624 12:46429599-46429621 CAGAATGTGGGGCACTACTCTGG + Intergenic
1096679447 12:53245621-53245643 CAGAATGTGGGACATTCTAAAGG + Intergenic
1097592787 12:61592017-61592039 CAGAATTCGGGCCTGTCTTCAGG + Intergenic
1098283095 12:68881299-68881321 CAGAATATGTGGCATTCTACAGG + Intronic
1099089742 12:78291155-78291177 CATAATCATGGGCAGTCTTCTGG - Intergenic
1099793797 12:87370314-87370336 CAGATTGGGAGGCAGTCTGCTGG + Intergenic
1102815066 12:115858830-115858852 CAGAATGAGGGGAAGACTTTGGG + Intergenic
1103216016 12:119202096-119202118 CAGAATGTGGGGCTGCCTGGAGG + Intronic
1105272920 13:18894626-18894648 CAGGATGTGGGGCAGTAGCCTGG + Intergenic
1105594161 13:21820394-21820416 CAGAATGTGGGGCATTCTCCAGG - Intergenic
1107168216 13:37308281-37308303 CAGAGTGTGTGGCAGTCATAAGG + Intergenic
1110059297 13:71021398-71021420 CAGAATGTGGGACATTCCACAGG + Intergenic
1113983676 13:114296690-114296712 CTGAAAGGGGGGCAGTCTTGTGG + Intronic
1114334314 14:21672112-21672134 CAGATTGTGGGGCAGGGTTAGGG + Intergenic
1118776657 14:68978164-68978186 CAGAACGAGGGTCAGTCTTAGGG - Intronic
1119346204 14:73926754-73926776 CAGAATGTGGGAAAATCTTTAGG - Intronic
1119607969 14:76037075-76037097 CAGAATGTGGGAAATTCTACAGG - Intronic
1120105490 14:80489532-80489554 CAGACTCTGGGGGAGTCTGCTGG - Intronic
1120820601 14:88908440-88908462 CAGAATGTGGGGTCAGCTTCTGG + Intergenic
1123042595 14:105496492-105496514 CAGAGTGTGGAGCAGGCTGCAGG - Intronic
1123107005 14:105846336-105846358 CAGAATGTGTGGCTGCCTGCTGG + Intergenic
1124611245 15:31210530-31210552 CAGAATGTGAGACATTCTTCAGG + Intergenic
1125191209 15:36996314-36996336 AAGAATGTGGGGCAGCTTTGGGG + Intronic
1125756040 15:42065649-42065671 CTGAAGTTGGGGCAGTCTTGTGG - Intergenic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1128465020 15:67903193-67903215 CTGAATTGGGGGCAGTCTTGTGG + Intergenic
1129410323 15:75347482-75347504 CAGGCTTTGGGGCAGGCTTCGGG - Intronic
1129685492 15:77684135-77684157 CAGAGTGTGGGGGAGTGTTTGGG - Intronic
1129806150 15:78459859-78459881 TAGAATGTGGGACATTCTACAGG - Intronic
1131910437 15:97193943-97193965 GGGAATCTGGGGCAGTCATCGGG + Intergenic
1132178196 15:99732527-99732549 CAGTATGTGGGGCAAGCTACGGG + Intronic
1137588092 16:49676439-49676461 CAGAATGTCAGGCAGCCTTGTGG - Intronic
1139482381 16:67237578-67237600 CAGAAAGTGGAGCAGTCATGGGG + Intronic
1140498832 16:75414867-75414889 AAGAACGTAGGGTAGTCTTCAGG - Intronic
1141818938 16:86431970-86431992 CAGAATGTGGGGCAGTAGGGTGG + Intergenic
1143210416 17:5182763-5182785 CTGAATGTGGGAAAGCCTTCAGG - Exonic
1143551431 17:7632749-7632771 CAGAAGGTGGTGTTGTCTTCTGG + Exonic
1143643457 17:8213713-8213735 CAAAGTGAGGGGCAGTCTTGTGG - Intergenic
1144130304 17:12240348-12240370 CAGACTGGGGGACAGTCTACGGG - Intergenic
1144371519 17:14595996-14596018 CCCAATGCGGGTCAGTCTTCTGG + Intergenic
1148751184 17:49946809-49946831 CAGACTGCGGGGCGGTCTTGAGG + Intergenic
1148983780 17:51602501-51602523 CTGAAGTTGGGGCAGTCTTGTGG + Intergenic
1149279033 17:55081655-55081677 CAGACTCTGGGGCAGTCAGCAGG + Intronic
1150055870 17:62015004-62015026 CAGAATGTGGGGCACTCTATAGG + Intronic
1150506655 17:65705639-65705661 CAGAATGTGGGACATTCTACAGG + Intronic
1151147887 17:72058232-72058254 CTGAATGTGGGCCTGTGTTCTGG - Intergenic
1151445254 17:74159511-74159533 CAGAATGTGGGGCAGCCCAGTGG + Intergenic
1157130676 18:45004543-45004565 AAGAATGTGGGTAACTCTTCAGG + Intronic
1157322526 18:46645580-46645602 CAGAAGATGGGGCCTTCTTCTGG + Intronic
1157771545 18:50351743-50351765 TAGAATGTGTGGCTGTGTTCAGG + Intergenic
1158490150 18:57902694-57902716 CAGAATGTGAGGCTGACCTCAGG - Intergenic
1159467587 18:68804545-68804567 CAGAATGTGGGGCAGCTACCAGG + Intronic
1159804059 18:72933890-72933912 CAGAATGTGGGAGAGTCTGCAGG + Intergenic
1159911577 18:74151258-74151280 CAGAAACTGGGGCAATGTTCAGG + Intronic
1159934146 18:74348245-74348267 CAGAATATGGGACATTCTCCAGG - Intronic
1160367892 18:78344279-78344301 GAAAGTGTGGGGCAGTCTTCCGG + Intergenic
1162288286 19:9757613-9757635 AAGAATGTGGGAAAGCCTTCAGG - Exonic
1163301125 19:16447110-16447132 CAGAATGTGGGCCGGCCTGCTGG - Intronic
1163384528 19:16991384-16991406 CAGAATTTAGGGTAGTCTTGTGG + Intronic
1163977138 19:20863065-20863087 CAGATTGTGGAGCTGACTTCGGG + Intronic
1164072520 19:21781345-21781367 CAGACAGTGGGAAAGTCTTCTGG - Intergenic
1165476184 19:36032387-36032409 CAGAGTTGGGGGCAGCCTTCAGG + Exonic
1165676757 19:37732636-37732658 AAGAATGTGGGACATTCTTTGGG + Intergenic
1165720365 19:38074565-38074587 CGGACTGTGGGGCAGGGTTCAGG + Intronic
1165747807 19:38240663-38240685 CAGGAGGTGGGGCAGTCGGCAGG + Intergenic
1167714938 19:51137203-51137225 CAGAAAGTGGGGGAGACATCAGG - Intergenic
1167845071 19:52155907-52155929 ATGAATGTGGCACAGTCTTCAGG - Exonic
1167876320 19:52416255-52416277 AAGAATGTGGCAAAGTCTTCAGG + Exonic
926520184 2:13900822-13900844 GAAAATGTGGAGCAGTTTTCAGG + Intergenic
926767923 2:16338410-16338432 CACCATGTGGGCCAGTCTTCAGG - Intergenic
927098026 2:19762994-19763016 AGTAATGTGGGGCTGTCTTCTGG - Intergenic
927545985 2:23953730-23953752 CAGAATGTGGGAAATTCTTTAGG - Intronic
930284288 2:49408883-49408905 CAGAATGAGGGAAAGCCTTCAGG - Intergenic
930359495 2:50359715-50359737 CTGAATGTGGGCCTGTCTTGCGG - Intronic
931618414 2:64185474-64185496 CAGAATCTGAGGCAGTATCCAGG + Intergenic
932723479 2:74157551-74157573 CCAAATGGGGGGCAGTCTTGTGG + Intronic
934894244 2:98100239-98100261 CAGATTCTGGGCAAGTCTTCTGG + Intronic
934980520 2:98836062-98836084 CAGAATATGGGACATTCTGCAGG + Intronic
935170443 2:100607416-100607438 CAAAATCTGGGCCAGCCTTCAGG - Intergenic
937149662 2:119677892-119677914 CAGAATGTGGGACATTCTACAGG - Intergenic
937236315 2:120433636-120433658 CAGAGTGTGGGCCTGTCTTCTGG - Intergenic
937767758 2:125680835-125680857 CAGTATTTGGGGGTGTCTTCCGG + Intergenic
938743914 2:134259366-134259388 CAGAATTTGGGTCAGGCTGCTGG - Intronic
942803864 2:179907062-179907084 CATAATCTGGGGCAGTTTTAGGG - Intergenic
943164583 2:184304324-184304346 CAGAATGTGGGGAACAATTCAGG - Intergenic
943603683 2:189950995-189951017 CAGAATATGGGGAATTTTTCTGG + Intronic
945275622 2:207984828-207984850 CAGAATGTGGGAAATTCTACAGG - Intronic
946667979 2:222071102-222071124 CAGAATGTGGGAAATTCTACAGG - Intergenic
948530388 2:238600176-238600198 AAGAATGTGGCGCAGCCTCCTGG + Intergenic
1169261809 20:4144699-4144721 CTGAAGCTGGGGCAGTCTTGTGG + Intronic
1171142443 20:22754965-22754987 CAGAGTGTGGAGCAGGATTCTGG - Intergenic
1174534055 20:51237217-51237239 CAGAAGTTGGGGGAGTCTTTTGG + Intergenic
1175027468 20:55917886-55917908 CAGAATGGGGGACATTCTGCAGG - Intergenic
1175689474 20:61055142-61055164 CAGAATGTGGGGCAGAGCTTTGG + Intergenic
1176809842 21:13526179-13526201 CAGGATGTGGGGCAGTAGCCCGG - Intergenic
1178272845 21:31209040-31209062 CAGAACCTGGGTTAGTCTTCAGG - Intronic
1178749264 21:35284854-35284876 AAGGATGTAGGGCAATCTTCTGG - Intronic
1179818608 21:43923536-43923558 CTGACAGTGGGGCAGTCTTGTGG - Intronic
1180450154 22:15454606-15454628 CAGAATTTGTAGCAGTGTTCTGG - Intergenic
1180622913 22:17173668-17173690 CAGATTTTGGGGCAGTCCTGAGG + Intergenic
1181549289 22:23627777-23627799 CAGAAACTGGGGCAGCCTCCAGG + Intronic
1181725324 22:24806892-24806914 CCGAAGGTGGGGCACGCTTCAGG + Intronic
1181799323 22:25334103-25334125 CAGAAGCTGGGGCAGCCTCCAGG - Intergenic
1182563773 22:31182802-31182824 CAGAATGTGGGACTTTCTACAGG - Intronic
1182984839 22:34706578-34706600 CACAGTGAGGGGGAGTCTTCTGG + Intergenic
1183922644 22:41181727-41181749 CAGAATGTGGTGCACTCTTCTGG - Intergenic
1184334216 22:43843942-43843964 CAGAACTGGGGGCAGTCTTGTGG + Intronic
949933358 3:9097883-9097905 CGGACTGTGGTGCAGTCTTAAGG - Intronic
950139013 3:10602213-10602235 CAGAATGTGGGGGTCTGTTCTGG + Intronic
950208749 3:11101221-11101243 CTAAATGTGGGGCAGTATTCTGG + Intergenic
953052632 3:39359693-39359715 AAGAATTTAGGGCAATCTTCTGG - Intergenic
954325476 3:49861128-49861150 GATAATGGGGGGCAGCCTTCAGG - Intronic
955332952 3:58062617-58062639 CAGATTCCGGGGCAGTCTGCAGG - Intronic
957190425 3:77001324-77001346 TAAAATGTGTGGCATTCTTCTGG + Intronic
957986115 3:87574327-87574349 CAGAATGTGGGCCTGTCCTTGGG + Intergenic
959933592 3:112007940-112007962 CAGATTCTGGGGCAGTCTCCTGG - Intronic
961336508 3:126183393-126183415 CAGAATTTGGGGGAGTCTAGAGG - Intronic
961372808 3:126441609-126441631 CAGGACTTGGGGCAGTCTACAGG + Intronic
961476910 3:127152763-127152785 CACAGTGGGGGGCAGTCTTCAGG - Intergenic
961679477 3:128589518-128589540 CAGAATATGGGGGAGTTTTTAGG - Intergenic
962256196 3:133871818-133871840 CAGACTGTGGGCCAGGGTTCTGG - Intronic
962297389 3:134203442-134203464 CAGAATGTGGGAAAGTCTATGGG + Intronic
963481637 3:145882391-145882413 CAGAATGTGGGACACTCTGCAGG - Intergenic
967627680 3:191704252-191704274 TAGATGGTGGGGCAGTCTTCAGG - Intergenic
968744207 4:2351108-2351130 CTGAATGGGGGGCCGTCTTGTGG + Intronic
969764031 4:9213906-9213928 CAGAATTTGGGTGTGTCTTCCGG - Intergenic
969764640 4:9218653-9218675 CAGAATTTGGGTGTGTCTTCCGG - Intergenic
969765244 4:9223401-9223423 CAGAATTTGGGTGTGTCTTCCGG - Intergenic
969765855 4:9228145-9228167 CAGAATTTGGGTGTGTCTTCCGG - Intergenic
969766464 4:9232889-9232911 CAGAATTTGGGTGTGTCTTCCGG - Intergenic
969767079 4:9237632-9237654 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969767686 4:9242379-9242401 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969768293 4:9247128-9247150 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969768896 4:9251878-9251900 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969769501 4:9256627-9256649 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969770118 4:9261373-9261395 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969770722 4:9266121-9266143 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969771337 4:9270868-9270890 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969771705 4:9323669-9323691 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969772318 4:9328414-9328436 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969772934 4:9333160-9333182 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969773551 4:9337907-9337929 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969774166 4:9342652-9342674 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969774781 4:9347397-9347419 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969775397 4:9352142-9352164 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969776011 4:9356887-9356909 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969776622 4:9361632-9361654 CAGAATTTGGGTGTGTCTTCCGG - Intronic
969777240 4:9366378-9366400 CAGAATTTGGGTGTGTCTTCCGG - Intergenic
971057459 4:22929801-22929823 AAGATTGTGGGGCTCTCTTCTGG + Intergenic
971174262 4:24265811-24265833 TAGAATGTGGGTGAGTCTTAAGG - Intergenic
971727410 4:30331460-30331482 CATCATGTGGGGCAGCCATCCGG + Intergenic
974047678 4:56910648-56910670 CAGGTAATGGGGCAGTCTTCTGG + Exonic
974173052 4:58292194-58292216 CAGAATTTGGGCCTGTCCTCAGG - Intergenic
974368033 4:60977509-60977531 CAGAATGAGAGGCATTGTTCAGG + Intergenic
976697949 4:87938075-87938097 CAGAATTTTGGGCAGTCTTTTGG - Intergenic
976841618 4:89438632-89438654 CTGAATGTGAGGCACACTTCTGG + Intergenic
982572954 4:157073820-157073842 CTGAATGTGGGGCAGATTTTAGG + Intergenic
985122953 4:186661917-186661939 CAGAATCTGAGGCTGTCTCCAGG + Intronic
986936044 5:12888081-12888103 CAGAATGTTGGCCAGACTTGAGG + Intergenic
987370344 5:17187323-17187345 CAGAAAGTGGGGCAGGCCTGTGG - Intronic
987548406 5:19344712-19344734 CAGCATGTGAGGAAGTCTTTGGG - Intergenic
989733625 5:44676561-44676583 CAACATGTAGGGCAATCTTCTGG - Intergenic
991253111 5:64585610-64585632 CTGATTGTGGGGCAGTCTCAGGG - Intronic
992660094 5:78950786-78950808 CAGAATGTGTGGCCGTCTTGTGG - Intronic
993545254 5:89203729-89203751 CAGAAGTTGGGGCAATCTTGTGG + Intergenic
993579367 5:89640027-89640049 TGGAAAGTGGGCCAGTCTTCAGG - Intergenic
997283187 5:132661291-132661313 CAGAAGGTGGGGCTTCCTTCAGG - Intergenic
998904481 5:146889788-146889810 CAGAAGTTAGGGCAGTTTTCGGG + Intronic
1001645406 5:173278109-173278131 CTGAATGTGTGGAAGTATTCTGG - Intergenic
1002079475 5:176728856-176728878 CAGAAGGTGGGGCTGGGTTCTGG - Intergenic
1003857342 6:10289974-10289996 CAGAATGAGGGGCAGTGATGTGG - Intergenic
1004497959 6:16182173-16182195 CAAAATGTGGGGCATTCCTGGGG + Intergenic
1004590946 6:17050978-17051000 CTGAAGTGGGGGCAGTCTTCTGG + Intergenic
1004808195 6:19227372-19227394 CAGACTCTGGGGGAGTCTGCTGG - Intergenic
1004864950 6:19844440-19844462 CAGAAAGAGGGGCAGTTTTGGGG - Intergenic
1005343036 6:24861284-24861306 CAGAATGTGGGGTAGTCTATAGG + Intronic
1005877316 6:30021148-30021170 CAGAATGTGGATCATTCTACAGG + Intergenic
1007607973 6:43130004-43130026 CACAATGTGGCTCACTCTTCAGG - Intronic
1010441204 6:75896765-75896787 CAAAATTTGGGGCAGTATTGTGG - Intronic
1011696348 6:89917310-89917332 CAGTAGGTGGGCCAGTCTTTAGG + Intergenic
1012451743 6:99359824-99359846 CAAAATGTGAGGCATTCTACAGG - Intergenic
1012607517 6:101176151-101176173 CAGAATGCAGGGCATTCTCCAGG - Intergenic
1012868015 6:104641271-104641293 TAGAATTTGGGGAAGTCTTATGG - Intergenic
1013280498 6:108631956-108631978 CAGAATGTGGGACATTCTGCAGG - Intronic
1014074614 6:117222096-117222118 CTGAAGTTGGGGCAGTCTTGTGG - Intergenic
1014859199 6:126443314-126443336 CAGACTGTGGGAAATTCTTCTGG - Intergenic
1016562508 6:145412880-145412902 CAGAATGAGGGGAAGGCATCTGG + Intergenic
1017037600 6:150280442-150280464 CAGACTGTGGGCCAGGTTTCAGG - Intergenic
1022473096 7:30693697-30693719 CTGAATTGGGGGCAGTCTTGTGG + Intronic
1023151121 7:37202413-37202435 AAGAATGTGGTGCAGTCTCTTGG - Intronic
1025948003 7:66119502-66119524 CTGAAGTAGGGGCAGTCTTCTGG + Intronic
1026318046 7:69244787-69244809 CTGAATGTGGGCCATTCTACAGG - Intergenic
1026473533 7:70714674-70714696 CAGAATGTGGGGCAGTCTTCAGG - Intronic
1026646986 7:72180113-72180135 TGGAATGTAGGACAGTCTTCAGG - Intronic
1026931241 7:74224076-74224098 CAGAAGTGGGGCCAGTCTTCAGG - Exonic
1027521105 7:79209008-79209030 CAGAATCTGGGGTGGTCGTCGGG + Intronic
1028708870 7:93883984-93884006 CATAATGTTGGGCACTCTACAGG - Intronic
1029635696 7:101782273-101782295 CTGGAGGTGGGGGAGTCTTCTGG - Intergenic
1030008450 7:105141234-105141256 CAGAATGTCGGGCTGTTTGCAGG + Intronic
1030205037 7:106944333-106944355 CAGACAGTGGGGCAGGATTCCGG - Intergenic
1030244371 7:107365680-107365702 CTGAGTGTGGGGCAGACTACTGG + Intronic
1033841908 7:145385908-145385930 CACCATGTGGGCCAATCTTCAGG + Intergenic
1036864394 8:12382043-12382065 CAGAATTTGGGTGTGTCTTCAGG + Intergenic
1037187795 8:16085400-16085422 CAGAATGTGGTTCAGTGCTCTGG + Intergenic
1044542279 8:93421143-93421165 CAGAATGTGCTGAAGTCGTCTGG - Intergenic
1044620764 8:94188645-94188667 CAGATGGAGGGGCAGTCTGCAGG - Intronic
1045490267 8:102662894-102662916 GAGAATGTGGGGCAGTGCTGTGG + Intergenic
1045564556 8:103299503-103299525 CAGTTTTTGTGGCAGTCTTCTGG - Intronic
1045685519 8:104707440-104707462 CAGAATGTTGCCCAGTATTCTGG - Intronic
1047160416 8:122371573-122371595 GAGAATATGGGGCAGTGTTCAGG + Intergenic
1047404788 8:124576356-124576378 CTGAATTTGGGGCAGTCTCATGG + Intronic
1048218595 8:132519817-132519839 CATCATGTCAGGCAGTCTTCAGG + Intergenic
1048265227 8:132979868-132979890 CTGAAGTGGGGGCAGTCTTCTGG - Intronic
1048265366 8:132980658-132980680 CTGAAGTGGGGGCAGTCTTCTGG + Intronic
1049852702 8:144841865-144841887 CAGAGTGTGGGAAAGTCTTCAGG + Exonic
1049966433 9:784477-784499 CAGAATTGGGGACAGTCTTGTGG - Intergenic
1050001170 9:1078210-1078232 CAGAATGTGGTACAGTCTATAGG - Intergenic
1056252472 9:84763933-84763955 CAGAATGAGGGACATTCTACAGG - Intronic
1056635324 9:88326797-88326819 CTGAGGGTGGGGCAGTCTTGTGG + Intergenic
1057421462 9:94916348-94916370 CAGGATCTGGGGAACTCTTCTGG - Intronic
1186138151 X:6541734-6541756 AAGAAAGTGGGACAGTCTTCAGG - Intergenic
1187702429 X:21975658-21975680 CAGAATGTGAGGCATTCTAGAGG - Intronic
1189563893 X:42219502-42219524 CAGCATGTGGGGCTTTCTTTTGG + Intergenic
1190856961 X:54305563-54305585 CAGAATGTGGGACATTCTGTAGG - Intronic
1192568879 X:72185959-72185981 AAGAATCTGGGCCAGGCTTCCGG + Intronic
1192935838 X:75857916-75857938 CAGAATTTGGGCCTGTCTTCGGG - Intergenic
1193741948 X:85227642-85227664 CAGACTGTGGGGGACTCTACAGG + Intergenic
1193902908 X:87204350-87204372 CAGAAGGTGGGACAACCTTCTGG - Intergenic
1195016641 X:100787828-100787850 CAGAATTTGGGCCTGTCCTCGGG - Intergenic
1195729497 X:107951734-107951756 CAGAATATGGGACAGTCTAGAGG - Intergenic
1196299301 X:114036623-114036645 CAGAATGGGAGGCAGTCATCTGG + Intergenic
1198246257 X:134834970-134834992 CAGAATGTGGGACATTTTACAGG - Intronic
1198383347 X:136104877-136104899 CAGAATGAGTGGGAGTTTTCAGG + Intergenic
1199676590 X:150194804-150194826 CAGAATGTGGGGCGATCTATGGG - Intergenic