ID: 1026475018

View in Genome Browser
Species Human (GRCh38)
Location 7:70727783-70727805
Sequence GAGTAGGATTTTAACTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026475018_1026475025 25 Left 1026475018 7:70727783-70727805 CCTAACAAGTTAAAATCCTACTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1026475025 7:70727831-70727853 GACAATGTGGAAATGAAGGAAGG No data
1026475018_1026475023 12 Left 1026475018 7:70727783-70727805 CCTAACAAGTTAAAATCCTACTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1026475023 7:70727818-70727840 CTTCTGTGTTAGTGACAATGTGG No data
1026475018_1026475024 21 Left 1026475018 7:70727783-70727805 CCTAACAAGTTAAAATCCTACTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1026475024 7:70727827-70727849 TAGTGACAATGTGGAAATGAAGG 0: 1
1: 0
2: 1
3: 31
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026475018 Original CRISPR GAGTAGGATTTTAACTTGTT AGG (reversed) Intronic
904060229 1:27703656-27703678 GTGTAGCATTTTATCTTATTTGG - Intergenic
905725579 1:40248705-40248727 GAGTAGGAATTTAACTGGCTGGG + Intronic
908792139 1:67793439-67793461 GTTTGGGAATTTAACTTGTTAGG + Intronic
909308841 1:74119693-74119715 GAGTATTATTTTAATTTGGTGGG - Intronic
910525730 1:88175824-88175846 GATGATGATTTTAACTTCTTGGG + Intergenic
910858592 1:91720577-91720599 GAGTCTGAGTTTAAATTGTTTGG - Intronic
911312651 1:96314651-96314673 GAGAAGGTGTTTAAATTGTTTGG - Intergenic
919014189 1:192008828-192008850 GAGTATGATGTTAGCTTTTTAGG - Intergenic
919094994 1:193022711-193022733 GAATAGAATTTTAACCTATTTGG - Intronic
919559640 1:199100934-199100956 GTGTAGGGGTATAACTTGTTGGG + Intergenic
921034423 1:211362909-211362931 GAGTAGGTTATTAACATGTAAGG - Intronic
924310956 1:242742651-242742673 AAGTAGAATTTTAACTAGGTAGG + Intergenic
1067900926 10:50240751-50240773 GAGCAGAATTTTAAATGGTTAGG - Intronic
1068343657 10:55742013-55742035 GAGAAGGATGCAAACTTGTTGGG - Intergenic
1068881653 10:62055679-62055701 AGGTAGGATTTTAACTTTTAAGG - Intronic
1073040605 10:100601935-100601957 GGATGGGATTTGAACTTGTTTGG - Intergenic
1081128841 11:39351362-39351384 GTGTAGGATGTTAACATTTTGGG - Intergenic
1081443460 11:43106316-43106338 GATTAGGACTTAAACATGTTGGG - Intergenic
1086212153 11:84333295-84333317 CAGTTGTATTTTTACTTGTTAGG - Intronic
1087126368 11:94630138-94630160 GAGTAGGCTGTTAACTTTTGGGG - Intergenic
1087491959 11:98839027-98839049 AAGAAGCTTTTTAACTTGTTCGG + Intergenic
1088057345 11:105601156-105601178 TAGAAGCATTTTAATTTGTTTGG + Intergenic
1088135282 11:106549689-106549711 GAGTAGGATTTAACCAGGTTTGG - Intergenic
1088679084 11:112223405-112223427 GAGTTGAAGTTTAACCTGTTTGG - Intronic
1091759740 12:3078775-3078797 GAGTAGGATTTTTTTTTTTTTGG + Intronic
1093180109 12:15957214-15957236 TGATAAGATTTTAACTTGTTTGG - Intronic
1097776770 12:63656192-63656214 GAGTTGGATTTAATCATGTTGGG - Intronic
1099354484 12:81617091-81617113 AAGTAGGTTTTTAACTTACTAGG + Intronic
1101707408 12:107233290-107233312 GAGCATGATTTTAACATGTGTGG - Intergenic
1103418017 12:120757669-120757691 GAGTAGGATTTAAATGTATTTGG + Intergenic
1109539567 13:63756289-63756311 GTGTAAGATTTTGAATTGTTTGG - Intergenic
1109544277 13:63823546-63823568 GTGTAAGATTTTGAATTGTTTGG + Intergenic
1110498151 13:76193375-76193397 GAGTATGGTTTAAACTTTTTTGG + Intergenic
1112066684 13:95800334-95800356 GAGTAGTATTTTAACTCTATGGG + Intergenic
1112119044 13:96389544-96389566 GAATAGCATTTTAAAATGTTAGG - Intronic
1114947006 14:27695292-27695314 CCGTAGTATTTTAACTTTTTAGG + Intergenic
1116522460 14:45866904-45866926 GATTAGGATTTGAAGTTGTCTGG + Intergenic
1116619368 14:47179045-47179067 CATTAGAATGTTAACTTGTTTGG + Intronic
1118874915 14:69775815-69775837 GAATAGGATCTGAACTTTTTAGG + Exonic
1119881199 14:78101258-78101280 GATTAGGCTATGAACTTGTTTGG + Intergenic
1119908778 14:78330477-78330499 GAGAAAGATTTAAATTTGTTTGG - Intronic
1121167075 14:91813441-91813463 GAATAGGATTTTAGCAAGTTGGG - Intronic
1121655653 14:95593745-95593767 GAGTAGGTTTCTAACCTGATGGG - Intergenic
1121773378 14:96572828-96572850 AAGTAGAATTTTCACATGTTAGG + Intergenic
1126498529 15:49319260-49319282 AAGTAGTATTTTAAAGTGTTTGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131359556 15:91778201-91778223 GAGTAGGAGTGTAAATTGTTGGG + Intergenic
1137737199 16:50733737-50733759 AAGTAGGATTTTACCTTGCTGGG - Intergenic
1139216090 16:65124707-65124729 GAGTAGAATCCTAACTTGCTGGG - Intronic
1139294173 16:65885650-65885672 GAGGTTGATTTTAACTTGCTTGG - Intergenic
1141013306 16:80423649-80423671 CAGCAGCAGTTTAACTTGTTAGG + Intergenic
1141296200 16:82772111-82772133 GAGCTGGATGTTAAATTGTTAGG + Intronic
1144034274 17:11351458-11351480 GAGTAGAATTTTTACTAGGTAGG - Intronic
1144407403 17:14965386-14965408 AAGTAGTATTTTTATTTGTTGGG + Intergenic
1146322128 17:31855316-31855338 AGATAGGATTTTACCTTGTTAGG - Intronic
1146547666 17:33752956-33752978 ATGTATGTTTTTAACTTGTTTGG - Intronic
1147571027 17:41571273-41571295 GTTTAGCATTTTAACTTTTTTGG + Intronic
1153363660 18:4228268-4228290 GAGTAGGATGTTTAAATGTTTGG - Intronic
1155042588 18:22077373-22077395 GGGGAGGCTTTTAACTTTTTAGG - Intergenic
1155049473 18:22134000-22134022 GTTTAAGATTTTAAGTTGTTTGG - Intergenic
1159162606 18:64662528-64662550 GAGTAGGAGTTTTAGTTCTTTGG + Intergenic
1163894040 19:20041533-20041555 TAGCATGATTTTAACTTTTTGGG - Intergenic
937570988 2:123361099-123361121 GATTAGGATGTTGACTTCTTTGG + Intergenic
939204447 2:139081868-139081890 GAGTAGGATTTAAAGTGGTCTGG + Intergenic
939299975 2:140323101-140323123 GAAATGGATTTTATCTTGTTTGG - Intronic
941616206 2:167722977-167722999 GAGTAGAATTTTTACCTGTAAGG - Intergenic
943983410 2:194587675-194587697 GATTAGGATGTTAACTTCTGTGG - Intergenic
944476274 2:200110181-200110203 AAGTAGGATTTTAATATGTAGGG - Intergenic
945233469 2:207612507-207612529 GAGTAGGATATGAGCTTTTTTGG - Exonic
1177467415 21:21505233-21505255 GAGTAGGATCTTAATCTGATGGG + Intronic
1177614599 21:23500609-23500631 GAATAGGATTTGAAATGGTTTGG + Intergenic
1177868352 21:26539886-26539908 AAGTAGCATTTTAATATGTTTGG + Intronic
1178380147 21:32100796-32100818 GAGTTGGATTTTACTGTGTTGGG - Intergenic
1178879662 21:36439215-36439237 GAGTGGCATTTTAAATTGATTGG - Intergenic
1179038891 21:37784296-37784318 GGGTGGGACTTTAACTTGTGGGG - Intronic
1179274639 21:39881032-39881054 GAGTAGAATTTTCACTTCTGCGG + Intronic
1183271822 22:36867071-36867093 GAGCAGGATTTTCACCTGCTTGG - Intronic
951495555 3:23321245-23321267 GATTAGGACTTCAACTTTTTTGG + Intronic
952505737 3:34005450-34005472 CAGTAGCATTTTTACTTGATGGG + Intergenic
953182814 3:40612573-40612595 GTTTAGGATTTGAATTTGTTTGG - Intergenic
955524639 3:59807831-59807853 GAAAAGGAATTAAACTTGTTTGG + Intronic
955767171 3:62356977-62356999 GAGAAGGATTTTCACTCCTTGGG + Intergenic
956576019 3:70753637-70753659 GAGTAGGATTTTAATGGGTATGG - Intergenic
957126037 3:76162070-76162092 AAGTAGGGTTTTAACTACTTTGG + Intronic
958807976 3:98834805-98834827 GGGGAGGCTTTTAACTTTTTAGG - Intronic
959242345 3:103813237-103813259 AATTATTATTTTAACTTGTTTGG + Intergenic
960439389 3:117668208-117668230 TTGTAGGATTTTGATTTGTTTGG - Intergenic
963619885 3:147593418-147593440 CAGTAAGTTTTTAATTTGTTGGG + Intergenic
963648482 3:147946603-147946625 AACTGGGATTTGAACTTGTTTGG - Intergenic
964053092 3:152419840-152419862 CAGCAGGATCTTAGCTTGTTGGG - Intronic
965906638 3:173715967-173715989 GAGTTGTATTTTAAATTATTTGG + Intronic
966710519 3:182967926-182967948 GAGGAGGATTAAAACATGTTAGG - Intronic
967881547 3:194305374-194305396 GACTAGTAGTTTAAATTGTTTGG + Intergenic
973558643 4:52111592-52111614 GACTGGGCTTGTAACTTGTTTGG - Intergenic
976500966 4:85788503-85788525 GTGTAGGATTTGACCTGGTTAGG + Intronic
977907363 4:102493567-102493589 CAGTAGCATTTTTTCTTGTTGGG - Intergenic
981026369 4:140080838-140080860 GAGTGGGATTTTACCTTATGTGG - Intronic
983092274 4:163517949-163517971 GAGTAGGATTTCGATTTTTTAGG + Intronic
984562780 4:181290594-181290616 GAGTAGGCTGTTAAATTGTATGG + Intergenic
986565415 5:9108850-9108872 GAGTGGTCTTTTAAATTGTTTGG - Intronic
990687213 5:58318530-58318552 GTGGAGGCTTTTCACTTGTTTGG + Intergenic
992087748 5:73293357-73293379 GGGTAAGATTTTGAGTTGTTTGG + Intergenic
992266089 5:75019517-75019539 GATTGGGATTTTAAGTTGTGTGG - Intergenic
993135419 5:83955252-83955274 TAGGAAGATTTTAACTTTTTTGG + Intronic
993735260 5:91468853-91468875 GAGTAGGATGATAGCTAGTTTGG + Intergenic
995012683 5:107275676-107275698 CAATAGGATTTTAACTTATTTGG - Intergenic
995500041 5:112794676-112794698 GAGTCGGCTCTTAACCTGTTGGG - Intronic
997569646 5:134916403-134916425 GAGTATGATTTTACTTGGTTGGG + Intronic
998291781 5:140923097-140923119 GAGTATGATTTTAAGTTTTTAGG + Intronic
1007010737 6:38415155-38415177 GAGTAGGATATGGACATGTTTGG - Intronic
1010933582 6:81833873-81833895 CAGTAGGATTTTAAGTTTTATGG - Intergenic
1011988062 6:93475162-93475184 GAGTAGGATTTTACCAAGTGAGG + Intergenic
1012886978 6:104858010-104858032 CAACATGATTTTAACTTGTTAGG + Intronic
1014712988 6:124830774-124830796 AATTAAAATTTTAACTTGTTTGG + Intergenic
1014903231 6:126994271-126994293 GAGTAGGAGTTTAATTTAGTAGG - Intergenic
1015771941 6:136777437-136777459 CAGTAGGATTTTAATTTTTCAGG - Intronic
1017785242 6:157751470-157751492 GATTCGGATTTTAATTTTTTTGG - Intronic
1018491563 6:164299066-164299088 GAATAAGATTTTAATATGTTGGG - Intergenic
1019354974 7:573684-573706 GACTCGGATTTTACCTTCTTGGG - Intronic
1020366447 7:7385689-7385711 GAGTAGCAAATTATCTTGTTAGG + Intronic
1020933412 7:14429177-14429199 GATTAGGATTTTAACATTTTGGG - Intronic
1022361653 7:29665587-29665609 GAGTTGGATTTAATCATGTTGGG + Intergenic
1022699736 7:32748134-32748156 GAGTTGGATTTAATCATGTTGGG - Intergenic
1026475018 7:70727783-70727805 GAGTAGGATTTTAACTTGTTAGG - Intronic
1027487212 7:78776853-78776875 GAGTAGAATCTTTACCTGTTAGG - Intronic
1029831643 7:103266585-103266607 GAGTTGGATTTAATCATGTTGGG - Intergenic
1030373112 7:108723083-108723105 GAGTAGAATTTGTTCTTGTTAGG - Intergenic
1030446564 7:109652781-109652803 GACTAGGATATTAACATCTTTGG - Intergenic
1030938855 7:115619780-115619802 GATTATGATTTTAGGTTGTTTGG - Intergenic
1037874855 8:22538189-22538211 GTGTATGATATTACCTTGTTTGG - Intronic
1038938487 8:32278519-32278541 GAGTAGGAATTTCAATTCTTGGG + Intronic
1040430980 8:47342116-47342138 GAGGAGGATTTTGTCTAGTTTGG + Intronic
1040672937 8:49714005-49714027 GAGTTGGATTTTAACAGGTAAGG - Intergenic
1042588665 8:70372458-70372480 GAGTAGGATTTTGGGTTGGTGGG - Intronic
1050050552 9:1596531-1596553 GATTAGGATTTTAACATTTTAGG + Intergenic
1050979155 9:11987070-11987092 GAGTACTGTTTTAACTTCTTTGG + Intergenic
1050994488 9:12197642-12197664 TCTTAGCATTTTAACTTGTTTGG + Intergenic
1051810871 9:21048269-21048291 GATTAGGCATTTAGCTTGTTTGG + Intergenic
1056298680 9:85220000-85220022 GAGATGAATTTTAATTTGTTTGG + Intergenic
1056896997 9:90560208-90560230 GAGTAAGAATTCAAATTGTTAGG + Intergenic
1058648956 9:107157194-107157216 GAGTTTGGTTTGAACTTGTTAGG - Intergenic
1060064144 9:120488112-120488134 TACTAGGATTTTAAATAGTTAGG - Intronic
1187119843 X:16393972-16393994 GAATATGAATTTAACTTGTAGGG + Intergenic
1188808741 X:34624917-34624939 TAGTCTGATTTTAACTTATTGGG + Intergenic
1189605003 X:42667754-42667776 AAGTTGGATTTTAAATTGTAAGG - Intergenic
1195042434 X:101026737-101026759 TAGTAGGATTTTCACTTAGTAGG - Intronic
1196279511 X:113806657-113806679 GAATAAGATTCTAACTTTTTCGG - Intergenic
1198040269 X:132844142-132844164 GAGGTGGCTTTTAACTTTTTGGG + Intronic
1202198799 Y:22325715-22325737 GAGGAGGAGTTTAAAATGTTGGG - Intronic