ID: 1026476452

View in Genome Browser
Species Human (GRCh38)
Location 7:70740038-70740060
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026476449_1026476452 -1 Left 1026476449 7:70740016-70740038 CCTTTGAATGTGCTCCAACTCAT 0: 1
1: 0
2: 0
3: 3
4: 123
Right 1026476452 7:70740038-70740060 TGCACAGCCCCTTTAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr