ID: 1026482220

View in Genome Browser
Species Human (GRCh38)
Location 7:70789415-70789437
Sequence TTGACCACATGCAGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482217_1026482220 14 Left 1026482217 7:70789378-70789400 CCAGACAGTCGGGCTGGATTGCC 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG 0: 1
1: 0
2: 2
3: 16
4: 158
1026482218_1026482220 -7 Left 1026482218 7:70789399-70789421 CCACATCATTGCCTTATTGACCA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG 0: 1
1: 0
2: 2
3: 16
4: 158
1026482214_1026482220 23 Left 1026482214 7:70789369-70789391 CCCGGGAGTCCAGACAGTCGGGC 0: 1
1: 0
2: 2
3: 7
4: 96
Right 1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG 0: 1
1: 0
2: 2
3: 16
4: 158
1026482215_1026482220 22 Left 1026482215 7:70789370-70789392 CCGGGAGTCCAGACAGTCGGGCT 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG 0: 1
1: 0
2: 2
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482220 Original CRISPR TTGACCACATGCAGCCATCT TGG Intronic
900785339 1:4646194-4646216 TTGAACACATGCTGCCTGCTAGG + Intergenic
901159622 1:7165151-7165173 TTGACAACATTCATCCATCCTGG - Intronic
903135375 1:21306032-21306054 TTCTCCACATCCAGCCATATGGG + Intronic
907047984 1:51311655-51311677 ATGACCACATGCAGCTGTCCTGG - Intronic
907635826 1:56134008-56134030 TGGACAAGATCCAGCCATCTAGG + Intergenic
910129534 1:83886985-83887007 TTTATCACATGCAGCCTCCTGGG - Intronic
911074849 1:93863153-93863175 TTGACCAGAAGCAGCCATCTTGG - Intergenic
913110913 1:115656402-115656424 TTTACCACCTGCAGTCACCTGGG + Intronic
913475923 1:119237729-119237751 TTGACACCATGCAGCCATTTAGG + Intergenic
915025598 1:152826798-152826820 TCAACCAAATACAGCCATCTGGG + Intergenic
922705801 1:227789418-227789440 TTGCCCTCCTGCAGCCTTCTGGG + Intergenic
924386416 1:243502439-243502461 TTGTCATAATGCAGCCATCTTGG - Exonic
1063300134 10:4843675-4843697 ATGCCCACCTGCAGCCAGCTTGG - Intronic
1069412726 10:68169662-68169684 TTGACCACCATCAGCCGTCTTGG - Intronic
1070326271 10:75391363-75391385 CTGAGCTCAAGCAGCCATCTCGG + Intergenic
1071467716 10:85956545-85956567 TTGACCACAAGGGACCATCTTGG + Intronic
1073548242 10:104371913-104371935 TTGACAACTTACAGCCACCTGGG - Intronic
1075440529 10:122476394-122476416 TTAACCACCTGCCTCCATCTGGG + Intronic
1076730049 10:132433906-132433928 TTGACCACATGCAGCTCGGTTGG + Intergenic
1078549056 11:12268094-12268116 TGCAGAACATGCAGCCATCTCGG + Intergenic
1081503357 11:43689235-43689257 TTCACCACATGCAGCCTTTTAGG + Intronic
1082797149 11:57386550-57386572 TTGATCACATGAGGTCATCTAGG + Intergenic
1082968382 11:58992331-58992353 GTGCCCACCTGCAGCCATCATGG + Intronic
1084573029 11:69970866-69970888 TTGAGCCCAAGCAGCCATCTTGG - Intergenic
1085948072 11:81296551-81296573 TTAACCACATGCCACCATTTTGG - Intergenic
1089725095 11:120470268-120470290 TTAACCTCTTGCAGCAATCTAGG + Intronic
1092973518 12:13721767-13721789 TAGACCAGATGAAGTCATCTAGG + Intronic
1093718109 12:22407014-22407036 TTGACATCATGCCACCATCTTGG + Intronic
1094365082 12:29671765-29671787 TTGATCACATGCACCCCTCCTGG - Intronic
1094700812 12:32868990-32869012 CAGACCACATGCTGCCATCCAGG - Exonic
1095814326 12:46404972-46404994 TTGACCACCTGCAGCCATTCTGG - Intergenic
1100870032 12:98901064-98901086 TTGACCTCATGCAGTCTTATAGG - Intronic
1101938112 12:109075645-109075667 CTGACCACATGCTGTCATTTTGG + Intronic
1103387682 12:120546282-120546304 TTGACCACCTTCAGGAATCTGGG - Intronic
1104784549 12:131441083-131441105 TTGACCCCGTGCATCCATCCTGG + Intergenic
1104794350 12:131506831-131506853 TGGAGCTCATGCAGCCATCTTGG - Intergenic
1105881688 13:24611683-24611705 TTGCCCACATACAGTCATCAGGG - Intergenic
1106121731 13:26865324-26865346 TGGAGCTCAAGCAGCCATCTTGG + Intergenic
1109164068 13:59011258-59011280 TTGACCACACGCAGCCACCTTGG + Intergenic
1110167183 13:72457417-72457439 TTGTCCAAATGCAGCTACCTTGG + Intergenic
1111222373 13:85221061-85221083 TTGACCAATTTCACCCATCTGGG + Intergenic
1113066977 13:106382626-106382648 GTGGCCATATGTAGCCATCTGGG - Intergenic
1113764490 13:112872708-112872730 TGGCCCGCATGCTGCCATCTGGG + Intronic
1113863715 13:113507938-113507960 CAGCCCACAGGCAGCCATCTGGG + Intronic
1114497788 14:23145773-23145795 TTGGCAACATGAAGCCAACTAGG - Intronic
1116468437 14:45259964-45259986 TGGACAACATGCTGCCACCTAGG - Intergenic
1122120055 14:99548135-99548157 TGGACAACAAGCTGCCATCTGGG + Intronic
1127054218 15:55115272-55115294 TTCAAAACATCCAGCCATCTGGG + Intergenic
1128249220 15:66152911-66152933 TTGCTCACATGCAGCCCTCCTGG + Intronic
1129233683 15:74210899-74210921 TGGATCTCAGGCAGCCATCTTGG + Intronic
1129513992 15:76145375-76145397 ATGACCACAGGCAGCCCTCTTGG - Intronic
1130411075 15:83649261-83649283 TTGGCCACAGGGAGCCACCTTGG + Intergenic
1132104151 15:99050748-99050770 CTGACCATCTGGAGCCATCTTGG + Intergenic
1132179021 15:99737656-99737678 CAGAGCACATGCAGTCATCTTGG + Intergenic
1134041584 16:11073014-11073036 TTGCCCCCAAGGAGCCATCTGGG - Intronic
1141602832 16:85136831-85136853 TTGAGCTCATGCAGCAAGCTAGG - Intergenic
1141866123 16:86751283-86751305 TTGGCCACATGTTGGCATCTGGG - Intergenic
1144026153 17:11277790-11277812 ATGAGCTCAGGCAGCCATCTTGG - Intronic
1144334293 17:14255271-14255293 TTGACCAGCTGCAGGCATCAGGG + Intergenic
1144389541 17:14780487-14780509 CTGACCACTTTCAGCCATCCCGG - Intergenic
1144492448 17:15725389-15725411 TTGGCCACAGGCGGGCATCTGGG - Intergenic
1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG + Intronic
1145775290 17:27523754-27523776 TGGACCTCCAGCAGCCATCTAGG - Intronic
1147336233 17:39728205-39728227 TGGACCCCTTCCAGCCATCTGGG - Exonic
1149442322 17:56685138-56685160 TTGACCACCTGGAGACATCATGG + Intergenic
1151409996 17:73917750-73917772 TGGAGCACATGAAGCCATCTGGG - Intergenic
1157505597 18:48223985-48224007 TGGACCTCCAGCAGCCATCTTGG + Intronic
1160752029 19:738869-738891 GTGAGGACATGCAGCTATCTGGG + Intronic
1163013720 19:14441073-14441095 CAGACCACATGCAGCCAGCCTGG - Intronic
1163475680 19:17524805-17524827 TGGAGCACAAGCAGCCACCTTGG - Intronic
1164587064 19:29482580-29482602 GTGACCAGCTGCAGACATCTGGG - Intergenic
1167193590 19:48009815-48009837 CTGACCAGATGCACCCTTCTGGG - Intronic
1168064745 19:53912730-53912752 TTGACCCCATGCAGCAACCCGGG - Intronic
925964651 2:9052730-9052752 CTGTCAACATGCTGCCATCTGGG - Intergenic
926005300 2:9368872-9368894 TCTACCACAACCAGCCATCTCGG - Intronic
926923229 2:17960253-17960275 CTGACCACATGGAAGCATCTGGG - Intronic
927558426 2:24051521-24051543 TTGACAACTTGCAGGCAGCTTGG - Intronic
930688987 2:54339764-54339786 ATGACCACCACCAGCCATCTTGG + Intronic
931657185 2:64520302-64520324 TTGACAACAAGGTGCCATCTTGG - Intergenic
933692218 2:85187967-85187989 TTGATCACATGCAACAATATAGG + Intronic
933873317 2:86592133-86592155 TTGACCATTTCCAGCCATCTAGG - Intronic
934016374 2:87889476-87889498 TAGACCTCAGGCAGCCATCTTGG - Intergenic
937713655 2:125007785-125007807 TTTACTAAATGCAGCCATCATGG - Intergenic
941778073 2:169414326-169414348 TTGACCAGATGCAACCACTTGGG - Intergenic
946481578 2:220061913-220061935 CTGAGCACATGCAGCTCTCTTGG + Intergenic
948282086 2:236754633-236754655 TTGTCCTCATCCAGCCTTCTGGG + Intergenic
948875392 2:240824230-240824252 TGGACCACAGGAAGCCATCACGG - Intergenic
1169281781 20:4273978-4274000 TGGAACACCTGCAGCCATCTTGG + Intergenic
1170776417 20:19378646-19378668 TTGATCACGTGCATTCATCTTGG - Intronic
1171460430 20:25294984-25295006 CTGACCACATGCTGGGATCTGGG + Exonic
1172286585 20:33744968-33744990 CTGACCACAAGCAGCAATCTGGG - Intronic
1173224071 20:41151707-41151729 TTGGGCATATGCAGCCAGCTTGG + Intronic
1174454805 20:50641620-50641642 TTGACCCCTTCCAGCCATCCTGG + Intronic
1175298197 20:57923760-57923782 ATGGCCACAGGGAGCCATCTGGG - Intergenic
1180224001 21:46378481-46378503 CTGCCCACACGCAGGCATCTCGG - Intronic
1181768377 22:25108541-25108563 TCCACCACATGCAGCCTCCTAGG - Intronic
1183107571 22:35625804-35625826 TGGAGCTCAAGCAGCCATCTTGG - Intronic
1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG + Intergenic
950337010 3:12203089-12203111 TTGACAACATGAAACCACCTAGG - Intergenic
955341692 3:58130091-58130113 CTGACCACACTCAGCCTTCTCGG - Intronic
956399076 3:68857224-68857246 CTGAAAACATGCAGCTATCTGGG + Intronic
956944865 3:74209286-74209308 TTGATCACATTCAACCATTTAGG - Intergenic
960615191 3:119590071-119590093 TAGACAACATGTAGCAATCTTGG - Intergenic
961523131 3:127479610-127479632 TGACCCACATGCAGCCAGCTGGG + Intergenic
962102454 3:132356834-132356856 ATGACCACAAACAGCCATCAAGG + Exonic
964553000 3:157905671-157905693 TTTACCACATTTATCCATCTTGG - Intergenic
966507104 3:180717422-180717444 TAGACTACATGCAGACTTCTGGG + Intronic
968729872 4:2264641-2264663 AGGCCCACCTGCAGCCATCTGGG - Intergenic
970221349 4:13815200-13815222 TGGGCCACATGCAGCCCTGTGGG + Intergenic
970499064 4:16658454-16658476 TAGACCAGATGCAGACATCAGGG + Intronic
971189612 4:24414853-24414875 TAGAGCACAAGCAGCCATATTGG + Intergenic
972361236 4:38327331-38327353 TGGAGCTCAAGCAGCCATCTTGG - Intergenic
972436882 4:39043906-39043928 ATGACCACATTCAACCATCACGG + Intergenic
978213921 4:106174380-106174402 TTGACCAGATACAGCATTCTAGG + Intronic
980208110 4:129748410-129748432 TTGACCACATGCTGGAAGCTGGG - Intergenic
980248895 4:130287597-130287619 TTGACCACATTCATATATCTAGG + Intergenic
983791055 4:171797728-171797750 GTGACAACAAGCAGCCATCTTGG - Intergenic
984034608 4:174649707-174649729 TTCACCACATCCAGCCAGCATGG - Intronic
990947967 5:61269588-61269610 TTTACCACCTTCAGCCATCAAGG + Intergenic
992551803 5:77866440-77866462 ATGGCCACATGCAGCCACCCTGG - Intronic
995172465 5:109132770-109132792 TTCACCAGGTGCTGCCATCTGGG - Intronic
996709234 5:126527429-126527451 TTGCCCACATGCACACAGCTGGG - Intergenic
998480132 5:142456226-142456248 TTGTCCACAGGCAGCCAAATAGG + Intergenic
998708739 5:144796426-144796448 TTCCTCACATGCAGGCATCTGGG - Intergenic
1002788634 6:423242-423264 CTGGCCACATGCAGCCAACCTGG + Intergenic
1003016640 6:2473371-2473393 GTGAACACAGGCAGCCATCAGGG + Intergenic
1003221294 6:4163231-4163253 ATGGCCACATGCTTCCATCTGGG - Intergenic
1005460907 6:26069424-26069446 TTGGCCACCAGCATCCATCTTGG + Intergenic
1006086030 6:31595829-31595851 GCCACCACATCCAGCCATCTAGG + Intergenic
1008459317 6:51749749-51749771 TTAACCCCATGCAGGCATCCTGG + Intronic
1008892000 6:56505327-56505349 GCCACCACATGCAGCCATTTAGG - Intronic
1011173750 6:84536907-84536929 TGGAGCTCAGGCAGCCATCTTGG - Intergenic
1014158009 6:118134605-118134627 CTGACCACATACAGTCACCTTGG - Intronic
1015223068 6:130826706-130826728 ATGACCTCATGCAGCCAGCAAGG + Intergenic
1017606498 6:156140219-156140241 TTTACCACGTACAGCCATATAGG + Intergenic
1019637530 7:2084004-2084026 TTTTCCACATGCACCCAACTCGG + Intronic
1024768577 7:52690325-52690347 TTGCCAACAAGCAGCCCTCTGGG + Intergenic
1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG + Intronic
1031075496 7:117208511-117208533 GAGAACACATGCAGGCATCTTGG - Intronic
1031403173 7:121350356-121350378 TTAAGAGCATGCAGCCATCTTGG - Exonic
1031764890 7:125765657-125765679 CGGACCACATGCTGCCATCTTGG + Intergenic
1031975983 7:128093840-128093862 TTGACTACATGCAGCCCCTTAGG + Intergenic
1034903522 7:154923305-154923327 TTGACCACCCCCAGTCATCTGGG - Intergenic
1039000436 8:32973757-32973779 TTAACCTCATCCAGCCATGTAGG - Intergenic
1039137646 8:34344079-34344101 TTGACCTCATGTAGCCATTCAGG + Intergenic
1041223633 8:55676310-55676332 TTGACCACCTGCAAACCTCTGGG - Intergenic
1043483844 8:80679410-80679432 TTGGACCCATGCAGCAATCTGGG - Intronic
1044824024 8:96179433-96179455 GGGACGACATGCAGCCATCGGGG - Intergenic
1046185976 8:110718880-110718902 ATGACCTAAAGCAGCCATCTTGG - Intergenic
1048432227 8:134381268-134381290 TTGAACCCAGGCAGCCATCCGGG + Intergenic
1051707286 9:19893883-19893905 GTGACCCACTGCAGCCATCTTGG - Intergenic
1053667927 9:40329472-40329494 GAGACCACATGCAGCCTCCTGGG + Intergenic
1053917734 9:42955759-42955781 GAGACCACATGCAGCCTCCTGGG + Intergenic
1054379073 9:64469511-64469533 GAGACCACATGCAGCCTCCTGGG + Intergenic
1054516684 9:66046811-66046833 GAGACCACATGCAGCCTCCTGGG - Intergenic
1054780997 9:69165977-69165999 CTGACCACATGCAGACTCCTAGG - Intronic
1055769836 9:79705261-79705283 TTCAGCACATGAATCCATCTAGG - Intronic
1056607000 9:88094116-88094138 TTGACCACATTGAGACATCCTGG + Intergenic
1057070423 9:92094149-92094171 TTGGTCAGATGCATCCATCTTGG - Intronic
1057147338 9:92767140-92767162 TTGAAGACATGGAGCCAGCTTGG - Intergenic
1057503471 9:95614283-95614305 TTGACAACATGCTGCCCTCTGGG - Intergenic
1059342297 9:113604461-113604483 TGGAGCTCAAGCAGCCATCTTGG - Intergenic
1060664750 9:125426139-125426161 TTGACTGGAGGCAGCCATCTTGG + Intergenic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1186497364 X:10022286-10022308 TACACCTCATGCAGCCATCATGG - Intronic
1186747248 X:12582821-12582843 TTCACTACATGCTGCCTTCTGGG - Intronic
1187422900 X:19151814-19151836 TTGAGCTCCAGCAGCCATCTTGG + Intergenic
1187802283 X:23076853-23076875 TTAAGAGCATGCAGCCATCTTGG + Intergenic
1189900104 X:45697663-45697685 ATCACCATCTGCAGCCATCTTGG + Intergenic
1192735573 X:73846575-73846597 GTGACCACAAGCATGCATCTTGG - Intergenic
1194379174 X:93174201-93174223 TGGAACACATGCAGCCACCATGG - Intergenic
1195328492 X:103777242-103777264 ATGACCACATCCATCCAGCTGGG - Intronic
1199128111 X:144149064-144149086 TAGACCTCAGGCAGCCATCTTGG + Intergenic
1199199573 X:145071372-145071394 TTGACAACATGGAGGAATCTGGG - Intergenic