ID: 1026482452

View in Genome Browser
Species Human (GRCh38)
Location 7:70790399-70790421
Sequence CCCAGTGGAAAGAAGGGTAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482452_1026482470 30 Left 1026482452 7:70790399-70790421 CCCGTACCCTTCTTTCCACTGGG 0: 1
1: 0
2: 4
3: 13
4: 162
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482452_1026482462 1 Left 1026482452 7:70790399-70790421 CCCGTACCCTTCTTTCCACTGGG 0: 1
1: 0
2: 4
3: 13
4: 162
Right 1026482462 7:70790423-70790445 CCCCATCCGGGACCCCTTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1026482452_1026482460 0 Left 1026482452 7:70790399-70790421 CCCGTACCCTTCTTTCCACTGGG 0: 1
1: 0
2: 4
3: 13
4: 162
Right 1026482460 7:70790422-70790444 ACCCCATCCGGGACCCCTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482452 Original CRISPR CCCAGTGGAAAGAAGGGTAC GGG (reversed) Exonic