ID: 1026482459

View in Genome Browser
Species Human (GRCh38)
Location 7:70790414-70790436
Sequence GGTCCCGGATGGGGTCCCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482459_1026482472 28 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482472 7:70790465-70790487 CATTCACCGGAGAGACCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1026482459_1026482473 29 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482459_1026482470 15 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482459 Original CRISPR GGTCCCGGATGGGGTCCCAG TGG (reversed) Exonic