ID: 1026482459

View in Genome Browser
Species Human (GRCh38)
Location 7:70790414-70790436
Sequence GGTCCCGGATGGGGTCCCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482459_1026482470 15 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482459_1026482472 28 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482472 7:70790465-70790487 CATTCACCGGAGAGACCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1026482459_1026482473 29 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482459 Original CRISPR GGTCCCGGATGGGGTCCCAG TGG (reversed) Exonic
900419681 1:2550480-2550502 GTTCCAGCATGGGGCCCCAGGGG - Intergenic
900425542 1:2576791-2576813 GTTCCAGCATGGGGCCCCAGGGG + Intergenic
900598728 1:3494041-3494063 GGCCACTGATGGGGTCGCAGGGG + Exonic
901493268 1:9607433-9607455 GGCCTCAGCTGGGGTCCCAGAGG - Intronic
903274207 1:22210500-22210522 GGCCCGGGCTGGGGTCACAGAGG - Intergenic
904437467 1:30508067-30508089 GGTCCGGGTTGGAGTCCCTGTGG - Intergenic
904471986 1:30741754-30741776 GAGCCTGGCTGGGGTCCCAGGGG - Intronic
904938509 1:34148884-34148906 GGTGGCGGATGGGGTCCAAGAGG + Intronic
905798585 1:40829422-40829444 GGTCAAGGATGGGGGCCCTGAGG - Intronic
906526200 1:46494619-46494641 GCTCAGGGATGGGGGCCCAGTGG - Intergenic
910592983 1:88947635-88947657 GTTCCCTGATGGGGCTCCAGGGG - Intronic
921160892 1:212471494-212471516 GTTCAGGGATGGGGTCTCAGTGG - Intergenic
1062970693 10:1646066-1646088 GGTCCAGGAAAGGCTCCCAGAGG + Intronic
1064478750 10:15719498-15719520 GCTCCCGGGTCAGGTCCCAGCGG - Intronic
1065122919 10:22545464-22545486 GAACCCAGATGGGGTGCCAGGGG - Intronic
1067015698 10:42755170-42755192 GGGCCCGGAAGGGCTCCCCGGGG + Intergenic
1074149018 10:110741780-110741802 GGTCCTGGAGGGGTTCCTAGAGG - Intronic
1076892928 10:133293626-133293648 GGTCCAGGTTGGGGTCCACGAGG + Exonic
1077035633 11:493145-493167 GCTGCCGGAAGGGCTCCCAGGGG - Intergenic
1077154942 11:1087093-1087115 GGACCCGGAGGAGGACCCAGAGG - Intergenic
1077176264 11:1192346-1192368 AGTCCCATATGGGGTCACAGAGG - Intronic
1077224785 11:1435214-1435236 GGTGCCGGTGGGGGTCTCAGCGG + Intronic
1077254355 11:1573732-1573754 TGTCCCGGAAGGGAGCCCAGGGG + Intergenic
1080434356 11:32226076-32226098 TGTCCAGGAGGGGGTGCCAGGGG - Intergenic
1084456388 11:69270289-69270311 GGTACCGGAGGGAGTCCCACAGG + Intergenic
1085459173 11:76682839-76682861 GGTCCCTGGAGGGTTCCCAGGGG - Intergenic
1092217985 12:6695644-6695666 GGTCCCAGCTGGGGTACCAGAGG + Exonic
1095310719 12:40693371-40693393 GTGCCCGGATGGGCTCCGAGCGG + Intronic
1100398728 12:94208514-94208536 AGTCCCGGAGGGGATCCGAGCGG - Intronic
1101832659 12:108271477-108271499 GGGCCAGGATGGCTTCCCAGAGG - Intergenic
1103222240 12:119255481-119255503 GATGCAGGCTGGGGTCCCAGGGG - Intergenic
1112386713 13:98946575-98946597 GGTTCCGCATGGGGTCTCTGGGG - Intronic
1113936914 13:113999707-113999729 TGTCCCGGCTGGGGTCCGGGTGG + Intronic
1121716337 14:96078717-96078739 GGTACCTGAAGGGGTCCCAAAGG - Intronic
1122032913 14:98926603-98926625 GGTCCCTGAGGGGATACCAGAGG + Intergenic
1122668724 14:103353704-103353726 GGTCTCGGGTGGGGTCCGTGTGG - Intergenic
1125772006 15:42174639-42174661 GGTCCAGGATGGATTCCAAGAGG + Intronic
1128719765 15:69939823-69939845 AGTCCCGAATGTGATCCCAGGGG - Intergenic
1129030999 15:72617661-72617683 GGTCCTGGTTTGGGTCCCAATGG + Intergenic
1129672423 15:77614622-77614644 GGTCCCGGATGCGGGCGCGGCGG + Exonic
1129792234 15:78349080-78349102 GGGCCAGGATGGGGTCTAAGGGG - Intergenic
1130997629 15:88912690-88912712 GGGCCCGGGAGGGGACCCAGAGG - Intronic
1132653356 16:1031371-1031393 GGCCCCTGATGGGGGCTCAGAGG + Intergenic
1132978513 16:2722189-2722211 GGTCACTGATGGGATCTCAGAGG + Intergenic
1133930440 16:10227983-10228005 AGACCCTGGTGGGGTCCCAGAGG - Intergenic
1134813709 16:17188564-17188586 GGGCCCGGATGGCTTCCCTGAGG - Intronic
1134821633 16:17251838-17251860 GGTCCTGGAAGGCTTCCCAGAGG + Intronic
1136453820 16:30369716-30369738 GGTCCTGGTAGGGGTCCCGGTGG + Exonic
1138457388 16:57129212-57129234 GGTCCCTGCAGGGGTCCCCGTGG - Intronic
1139842549 16:69893169-69893191 GATCCGGGAGGGAGTCCCAGAGG - Intronic
1140507880 16:75485815-75485837 GGGACCTGATGGTGTCCCAGTGG + Intronic
1140895820 16:79323299-79323321 TGTCACGAATGGTGTCCCAGGGG + Intergenic
1141086232 16:81097215-81097237 GGTCCTGTTTGGGGTCCCTGGGG - Intergenic
1141289512 16:82704650-82704672 GGTCCAGGAAGGTTTCCCAGAGG + Intronic
1142192282 16:88723464-88723486 CCTCCCGGATGGGGACCCTGAGG + Intronic
1142366380 16:89652214-89652236 GGTTCCGGGTGGGTTGCCAGAGG - Intronic
1142366420 16:89652368-89652390 GGTTCCAGATGGGTTGCCAGAGG - Intronic
1142366440 16:89652445-89652467 GGTTCCAGATGGGTTGCCAGAGG - Intronic
1142366461 16:89652522-89652544 GGTTCCAGATGGGTTGCCAGAGG - Intronic
1142366482 16:89652599-89652621 GGTTCCAGATGGGTTGCCAGAGG - Intronic
1143023865 17:3929867-3929889 GGTCCAGGATTGGGTTCCAGGGG - Intronic
1143023909 17:3930012-3930034 GGTCCAGGATTGGGGTCCAGAGG - Intronic
1143625916 17:8110063-8110085 GACCCCGGGTGGGGGCCCAGCGG - Intronic
1144782852 17:17816601-17816623 GGTGACGGATGAGGTTCCAGAGG + Exonic
1147338879 17:39742360-39742382 AGTCCCAGGAGGGGTCCCAGGGG - Exonic
1149772395 17:59331962-59331984 GGTTCCGCGTGGGGTCCCCGTGG + Intronic
1151666808 17:75549841-75549863 GGTCCCGGAAGGGGAGCGAGTGG - Intronic
1152014912 17:77744277-77744299 GGGCCCTCATGGGGTCCCTGGGG + Intergenic
1152242513 17:79167848-79167870 GGTCCCGGATGAGCTCTGAGAGG - Intronic
1152398614 17:80050316-80050338 GGTCCTGGAGGGTTTCCCAGGGG + Intronic
1152938655 17:83154422-83154444 GTTCCTGGATTGGGTCCCAGAGG - Intergenic
1156478174 18:37419694-37419716 GGTACCGGAGGGCGTCCCTGAGG - Intronic
1157624791 18:49042304-49042326 CATCCCGGGTGGGGTCCCAGAGG - Exonic
1160017518 18:75155794-75155816 GGTCTCGCATGGCGCCCCAGGGG + Intergenic
1160917383 19:1503698-1503720 GCTGCCGGCGGGGGTCCCAGGGG - Intergenic
1160932140 19:1575836-1575858 GGGCCTGGATGGGCTTCCAGTGG + Intronic
1161135792 19:2618876-2618898 GCTCCTGGATGGGGTCACAATGG - Intronic
1161379295 19:3956144-3956166 GGCCTCCGGTGGGGTCCCAGAGG + Intergenic
1161611193 19:5243916-5243938 TGACCTGGATGGGGTCCGAGAGG + Exonic
1161652915 19:5496321-5496343 GTTCAGGGATGGGGGCCCAGTGG + Intergenic
1161784040 19:6312052-6312074 GGTCAAGGGTGGGGACCCAGGGG + Intronic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
1165110640 19:33500122-33500144 GGTCCAGGTTGGACTCCCAGTGG + Intronic
1165141745 19:33703992-33704014 GTTCGCGTCTGGGGTCCCAGAGG + Intronic
1165224105 19:34342062-34342084 AGTCCCGGCTGGGGTGTCAGAGG - Exonic
1165773323 19:38390452-38390474 GGTCCCGGAGGCGTTCCCCGTGG - Exonic
1166796906 19:45431849-45431871 TGTCCAGGCTGGGGTGCCAGGGG - Intronic
1166841095 19:45697583-45697605 GGCCAGGGAAGGGGTCCCAGAGG - Intronic
1166995099 19:46716391-46716413 GGTCCCGGGTGGGCTCCAGGCGG - Exonic
925975679 2:9140272-9140294 GGTCCCGGATGGGGTGCTCGAGG + Intergenic
927154619 2:20214358-20214380 TGTCCCTGAAGGAGTCCCAGGGG + Intronic
927711785 2:25330705-25330727 GGTCCCAGCTGTGGTCCCACTGG + Intronic
930011580 2:46941613-46941635 GCTCCGGCATGCGGTCCCAGTGG - Exonic
942104897 2:172624271-172624293 GTACCCGTATGGGGCCCCAGGGG - Intergenic
947818452 2:233054085-233054107 GTTCCCGGCTCTGGTCCCAGGGG + Intergenic
948808800 2:240464785-240464807 GGTCCTGGATGTGGCCCCATTGG + Intronic
1168788670 20:561419-561441 CGTCCTGGATGGCTTCCCAGAGG + Intergenic
1172801482 20:37579369-37579391 GGTACTGGCTGGGTTCCCAGTGG - Intergenic
1173396575 20:42686031-42686053 GGTCTTTGAGGGGGTCCCAGAGG - Intronic
1175569829 20:60010242-60010264 GGACACGCATGGGGTCCCTGGGG + Intronic
1175878325 20:62241635-62241657 GGTCCTGGGTGGGTTCCCACTGG + Intronic
1175996151 20:62813156-62813178 GGTCTCCGATGGGCTCCCAGGGG - Exonic
1176376269 21:6088285-6088307 GGGCTGGGATGGGGTCCCCGGGG - Intergenic
1178935661 21:36859475-36859497 GGACCCTGTGGGGGTCCCAGTGG - Intronic
1179510748 21:41871600-41871622 GGTCCCAGATTGGGAACCAGAGG - Exonic
1179646230 21:42778041-42778063 AATCCTGGATGGGGTCCCCGCGG + Intergenic
1179715148 21:43282514-43282536 GGTCCAGGAGGGGGTCCAGGAGG + Intergenic
1179747206 21:43449959-43449981 GGGCTGGGATGGGGTCCCCGGGG + Intergenic
1180918672 22:19506972-19506994 CTTCGTGGATGGGGTCCCAGTGG + Intronic
1182755105 22:32673005-32673027 GGCCCCAGATGGGGTTCAAGTGG + Intronic
1182931223 22:34176115-34176137 GGACCCGGATGGGGATCAAGAGG + Intergenic
1183297759 22:37041871-37041893 TGTCCTAGATGGGCTCCCAGAGG + Intergenic
1184513443 22:44946144-44946166 GGTCACGGAAGGCTTCCCAGAGG + Intronic
1185372755 22:50468549-50468571 GGTGCCAGATGAGGGCCCAGTGG - Intronic
1185381258 22:50508367-50508389 GGTCGCGGATGGGCTGCAAGAGG - Exonic
950756700 3:15179087-15179109 GGGCCCAGATGGGGTACCAATGG - Intergenic
954624547 3:52015477-52015499 GGTCCTGGAAGGCTTCCCAGAGG - Intergenic
955371038 3:58352202-58352224 GGTTCCAGAAGGGCTCCCAGGGG + Intronic
967805079 3:193708552-193708574 GGTCAGGGAAGGGCTCCCAGAGG - Intergenic
968551640 4:1226417-1226439 GGTTCCGCAAGGGGTCCCGGGGG + Intronic
969115526 4:4868543-4868565 GGGGCCGAAGGGGGTCCCAGAGG - Intergenic
969300004 4:6292140-6292162 GGGCCAGGATGGGGTCGCACAGG - Intronic
970277496 4:14417426-14417448 TGTCCCAGATGTGGTTCCAGAGG + Intergenic
970399387 4:15703137-15703159 GTTCCCCGATGGCGGCCCAGGGG + Exonic
976367627 4:84247600-84247622 AGGCCAGGGTGGGGTCCCAGAGG - Intergenic
984830722 4:183970478-183970500 GCCACCGAATGGGGTCCCAGGGG - Intronic
984999849 4:185471821-185471843 GGTCCCTGGTGGGGTCCCGGTGG + Intronic
1004041591 6:11983649-11983671 GGTCCAGGATGAAGTCGCAGTGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1007485493 6:42178240-42178262 GGGCCCGGATGGGCTCACGGCGG + Intronic
1016986801 6:149901305-149901327 GTCTCCGGATGGGGTCACAGTGG + Intergenic
1018460433 6:163993764-163993786 GGACCCAGATGAGGTGCCAGAGG - Intergenic
1019351238 7:554974-554996 GGTCCCTCATGGGGGCACAGAGG + Intronic
1019406235 7:885636-885658 GCTCCAGGCTGGGGTCCCACGGG - Intronic
1019437693 7:1030470-1030492 GGTGCCGGCTGAGGACCCAGGGG + Intronic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1027251554 7:76401752-76401774 GCTCCAGGATGGCTTCCCAGAGG - Intronic
1029864771 7:103615578-103615600 GATCCCTGATGGTCTCCCAGAGG - Intronic
1032491942 7:132330310-132330332 GGTCACTGCTGGTGTCCCAGAGG - Intronic
1034938236 7:155213533-155213555 GGTCCCTCATGGAGGCCCAGAGG + Intergenic
1035241546 7:157533862-157533884 GGTCCTGGATAAGGGCCCAGGGG - Intergenic
1038529712 8:28308432-28308454 GGTCCTGGATGTGGCCCCAAGGG + Intergenic
1038613113 8:29071728-29071750 GGTCCCGGAGTGGCTCCGAGAGG - Exonic
1049531946 8:143159427-143159449 GGGCCGGGCTGGGGTCGCAGGGG + Intronic
1050063010 9:1730069-1730091 AGCCCTGGTTGGGGTCCCAGAGG - Intergenic
1061034060 9:128103707-128103729 GGTCCCGGATGAGTTCACAGTGG + Exonic
1061171912 9:128962617-128962639 GGCCCAGGATGGGGTGCAAGTGG - Intronic
1061809617 9:133154791-133154813 GTTCCAGGAAGGAGTCCCAGAGG + Intronic
1061911732 9:133728594-133728616 GGGCTCTGATGGGGTCTCAGGGG - Intronic
1062030203 9:134358752-134358774 GGCCCCGGCTGGGGTCTCAATGG + Intronic
1062261507 9:135665370-135665392 GGTCCCCGAGGGGGTCAGAGGGG - Intronic
1062496944 9:136836396-136836418 GGTCCCTGCCTGGGTCCCAGGGG - Intronic
1062532920 9:137009581-137009603 GGTCAAGGATGAGGTTCCAGAGG + Exonic
1186477113 X:9866057-9866079 GGCCCCTGCTGTGGTCCCAGAGG - Intronic
1190330873 X:49234450-49234472 GGTCCCAGCTGGGGTCCCGCAGG + Intergenic
1195278947 X:103310832-103310854 GGACCCGGAGGGGGTCCCTGGGG - Exonic
1200164027 X:154023880-154023902 GGCCCCGGATGTGGGCCCAGAGG + Intronic
1200739392 Y:6836936-6836958 GGGCTCTGATGGGATCCCAGGGG - Intergenic