ID: 1026482464

View in Genome Browser
Species Human (GRCh38)
Location 7:70790425-70790447
Sequence ATCCCTCAAGGGGTCCCGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482464_1026482476 23 Left 1026482464 7:70790425-70790447 CCATCCGGGACCCCTTGAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1026482476 7:70790471-70790493 CCGGAGAGACCCGCTGGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 170
1026482464_1026482473 18 Left 1026482464 7:70790425-70790447 CCATCCGGGACCCCTTGAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482464_1026482470 4 Left 1026482464 7:70790425-70790447 CCATCCGGGACCCCTTGAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482464_1026482474 22 Left 1026482464 7:70790425-70790447 CCATCCGGGACCCCTTGAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1026482474 7:70790470-70790492 ACCGGAGAGACCCGCTGGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 100
1026482464_1026482472 17 Left 1026482464 7:70790425-70790447 CCATCCGGGACCCCTTGAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1026482472 7:70790465-70790487 CATTCACCGGAGAGACCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482464 Original CRISPR ATCCCTCAAGGGGTCCCGGA TGG (reversed) Exonic