ID: 1026482467

View in Genome Browser
Species Human (GRCh38)
Location 7:70790436-70790458
Sequence TCTCGGTAAGGATCCCTCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482467_1026482470 -7 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482467_1026482479 26 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482479 7:70790485-70790507 TGGGCAGGGACTTCCTGCTAAGG 0: 1
1: 0
2: 2
3: 16
4: 202
1026482467_1026482476 12 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482476 7:70790471-70790493 CCGGAGAGACCCGCTGGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 170
1026482467_1026482474 11 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482474 7:70790470-70790492 ACCGGAGAGACCCGCTGGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 100
1026482467_1026482473 7 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482467_1026482472 6 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482472 7:70790465-70790487 CATTCACCGGAGAGACCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482467 Original CRISPR TCTCGGTAAGGATCCCTCAA GGG (reversed) Exonic