ID: 1026482470

View in Genome Browser
Species Human (GRCh38)
Location 7:70790452-70790474
Sequence ACCGAGAACTTGACATTCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482468_1026482470 -8 Left 1026482468 7:70790437-70790459 CCTTGAGGGATCCTTACCGAGAA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482456_1026482470 23 Left 1026482456 7:70790406-70790428 CCTTCTTTCCACTGGGACCCCAT 0: 1
1: 0
2: 0
3: 36
4: 244
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482459_1026482470 15 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482452_1026482470 30 Left 1026482452 7:70790399-70790421 CCCGTACCCTTCTTTCCACTGGG 0: 1
1: 0
2: 4
3: 13
4: 162
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482464_1026482470 4 Left 1026482464 7:70790425-70790447 CCATCCGGGACCCCTTGAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482454_1026482470 29 Left 1026482454 7:70790400-70790422 CCGTACCCTTCTTTCCACTGGGA 0: 1
1: 0
2: 1
3: 20
4: 244
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482463_1026482470 5 Left 1026482463 7:70790424-70790446 CCCATCCGGGACCCCTTGAGGGA 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482467_1026482470 -7 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482455_1026482470 24 Left 1026482455 7:70790405-70790427 CCCTTCTTTCCACTGGGACCCCA 0: 1
1: 1
2: 2
3: 24
4: 319
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482466_1026482470 -6 Left 1026482466 7:70790435-70790457 CCCCTTGAGGGATCCTTACCGAG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482461_1026482470 6 Left 1026482461 7:70790423-70790445 CCCCATCCGGGACCCCTTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1026482465_1026482470 0 Left 1026482465 7:70790429-70790451 CCGGGACCCCTTGAGGGATCCTT 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1026482470 7:70790452-70790474 ACCGAGAACTTGACATTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482470 Original CRISPR ACCGAGAACTTGACATTCAC CGG Exonic