ID: 1026482473

View in Genome Browser
Species Human (GRCh38)
Location 7:70790466-70790488
Sequence ATTCACCGGAGAGACCCGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026482471_1026482473 -10 Left 1026482471 7:70790453-70790475 CCGAGAACTTGACATTCACCGGA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482465_1026482473 14 Left 1026482465 7:70790429-70790451 CCGGGACCCCTTGAGGGATCCTT 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482468_1026482473 6 Left 1026482468 7:70790437-70790459 CCTTGAGGGATCCTTACCGAGAA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482464_1026482473 18 Left 1026482464 7:70790425-70790447 CCATCCGGGACCCCTTGAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482467_1026482473 7 Left 1026482467 7:70790436-70790458 CCCTTGAGGGATCCTTACCGAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482463_1026482473 19 Left 1026482463 7:70790424-70790446 CCCATCCGGGACCCCTTGAGGGA 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482466_1026482473 8 Left 1026482466 7:70790435-70790457 CCCCTTGAGGGATCCTTACCGAG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482459_1026482473 29 Left 1026482459 7:70790414-70790436 CCACTGGGACCCCATCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482461_1026482473 20 Left 1026482461 7:70790423-70790445 CCCCATCCGGGACCCCTTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1026482469_1026482473 -5 Left 1026482469 7:70790448-70790470 CCTTACCGAGAACTTGACATTCA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1026482473 7:70790466-70790488 ATTCACCGGAGAGACCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026482473 Original CRISPR ATTCACCGGAGAGACCCGCT GGG Exonic