ID: 1026483842

View in Genome Browser
Species Human (GRCh38)
Location 7:70800984-70801006
Sequence GCTGGTGAGGCTCTGACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026483842_1026483846 -8 Left 1026483842 7:70800984-70801006 CCCCATGTCAGAGCCTCACCAGC No data
Right 1026483846 7:70800999-70801021 TCACCAGCACCCCATTGCCTTGG No data
1026483842_1026483847 -7 Left 1026483842 7:70800984-70801006 CCCCATGTCAGAGCCTCACCAGC No data
Right 1026483847 7:70801000-70801022 CACCAGCACCCCATTGCCTTGGG No data
1026483842_1026483852 2 Left 1026483842 7:70800984-70801006 CCCCATGTCAGAGCCTCACCAGC No data
Right 1026483852 7:70801009-70801031 CCCATTGCCTTGGGACCTCAGGG No data
1026483842_1026483850 1 Left 1026483842 7:70800984-70801006 CCCCATGTCAGAGCCTCACCAGC No data
Right 1026483850 7:70801008-70801030 CCCCATTGCCTTGGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026483842 Original CRISPR GCTGGTGAGGCTCTGACATG GGG (reversed) Intergenic
No off target data available for this crispr