ID: 1026483850

View in Genome Browser
Species Human (GRCh38)
Location 7:70801008-70801030
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026483844_1026483850 -1 Left 1026483844 7:70800986-70801008 CCATGTCAGAGCCTCACCAGCAC No data
Right 1026483850 7:70801008-70801030 CCCCATTGCCTTGGGACCTCAGG No data
1026483842_1026483850 1 Left 1026483842 7:70800984-70801006 CCCCATGTCAGAGCCTCACCAGC No data
Right 1026483850 7:70801008-70801030 CCCCATTGCCTTGGGACCTCAGG No data
1026483839_1026483850 14 Left 1026483839 7:70800971-70800993 CCCCATGACACTGCCCCATGTCA No data
Right 1026483850 7:70801008-70801030 CCCCATTGCCTTGGGACCTCAGG No data
1026483841_1026483850 12 Left 1026483841 7:70800973-70800995 CCATGACACTGCCCCATGTCAGA No data
Right 1026483850 7:70801008-70801030 CCCCATTGCCTTGGGACCTCAGG No data
1026483843_1026483850 0 Left 1026483843 7:70800985-70801007 CCCATGTCAGAGCCTCACCAGCA No data
Right 1026483850 7:70801008-70801030 CCCCATTGCCTTGGGACCTCAGG No data
1026483840_1026483850 13 Left 1026483840 7:70800972-70800994 CCCATGACACTGCCCCATGTCAG No data
Right 1026483850 7:70801008-70801030 CCCCATTGCCTTGGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026483850 Original CRISPR CCCCATTGCCTTGGGACCTC AGG Intergenic
No off target data available for this crispr