ID: 1026489573

View in Genome Browser
Species Human (GRCh38)
Location 7:70851113-70851135
Sequence GTTTAGGTCTGGAGCTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026489573_1026489583 18 Left 1026489573 7:70851113-70851135 CCTGGTCAGCTCCAGACCTAAAC No data
Right 1026489583 7:70851154-70851176 TAGCAGAGGGCGGCTTTGAGGGG No data
1026489573_1026489581 16 Left 1026489573 7:70851113-70851135 CCTGGTCAGCTCCAGACCTAAAC No data
Right 1026489581 7:70851152-70851174 ATTAGCAGAGGGCGGCTTTGAGG No data
1026489573_1026489582 17 Left 1026489573 7:70851113-70851135 CCTGGTCAGCTCCAGACCTAAAC No data
Right 1026489582 7:70851153-70851175 TTAGCAGAGGGCGGCTTTGAGGG No data
1026489573_1026489580 8 Left 1026489573 7:70851113-70851135 CCTGGTCAGCTCCAGACCTAAAC No data
Right 1026489580 7:70851144-70851166 CTGTAGCTATTAGCAGAGGGCGG No data
1026489573_1026489578 5 Left 1026489573 7:70851113-70851135 CCTGGTCAGCTCCAGACCTAAAC No data
Right 1026489578 7:70851141-70851163 AGCCTGTAGCTATTAGCAGAGGG No data
1026489573_1026489577 4 Left 1026489573 7:70851113-70851135 CCTGGTCAGCTCCAGACCTAAAC No data
Right 1026489577 7:70851140-70851162 GAGCCTGTAGCTATTAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026489573 Original CRISPR GTTTAGGTCTGGAGCTGACC AGG (reversed) Intergenic
No off target data available for this crispr