ID: 1026491019

View in Genome Browser
Species Human (GRCh38)
Location 7:70863559-70863581
Sequence TATGATGCACAGAGAGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026491016_1026491019 -1 Left 1026491016 7:70863537-70863559 CCAAGAGAGCATCCACAGTGTCT No data
Right 1026491019 7:70863559-70863581 TATGATGCACAGAGAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026491019 Original CRISPR TATGATGCACAGAGAGCTGG TGG Intergenic
No off target data available for this crispr