ID: 1026493211

View in Genome Browser
Species Human (GRCh38)
Location 7:70881014-70881036
Sequence ATCCTGTGGTCTCCCTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026493211_1026493214 3 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493214 7:70881040-70881062 GCAACATTAAGCTTGGCTTATGG No data
1026493211_1026493218 13 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493218 7:70881050-70881072 GCTTGGCTTATGGGGTGCGGCGG No data
1026493211_1026493217 10 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493217 7:70881047-70881069 TAAGCTTGGCTTATGGGGTGCGG No data
1026493211_1026493219 16 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493219 7:70881053-70881075 TGGCTTATGGGGTGCGGCGGAGG No data
1026493211_1026493213 -4 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493213 7:70881033-70881055 GGATAAAGCAACATTAAGCTTGG No data
1026493211_1026493216 5 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493216 7:70881042-70881064 AACATTAAGCTTGGCTTATGGGG No data
1026493211_1026493220 17 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493220 7:70881054-70881076 GGCTTATGGGGTGCGGCGGAGGG No data
1026493211_1026493215 4 Left 1026493211 7:70881014-70881036 CCTGATGAGGGAGACCACAGGAT No data
Right 1026493215 7:70881041-70881063 CAACATTAAGCTTGGCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026493211 Original CRISPR ATCCTGTGGTCTCCCTCATC AGG (reversed) Intergenic
No off target data available for this crispr