ID: 1026499946

View in Genome Browser
Species Human (GRCh38)
Location 7:70935629-70935651
Sequence CTGAATAAGGAAGAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026499946_1026499956 11 Left 1026499946 7:70935629-70935651 CCTGCCCCCTCTTCCTTATTCAG No data
Right 1026499956 7:70935663-70935685 TAGCATTTGAGGGTGGCCTCGGG No data
1026499946_1026499954 4 Left 1026499946 7:70935629-70935651 CCTGCCCCCTCTTCCTTATTCAG No data
Right 1026499954 7:70935656-70935678 AAAGAGCTAGCATTTGAGGGTGG No data
1026499946_1026499952 0 Left 1026499946 7:70935629-70935651 CCTGCCCCCTCTTCCTTATTCAG No data
Right 1026499952 7:70935652-70935674 TGTTAAAGAGCTAGCATTTGAGG No data
1026499946_1026499953 1 Left 1026499946 7:70935629-70935651 CCTGCCCCCTCTTCCTTATTCAG No data
Right 1026499953 7:70935653-70935675 GTTAAAGAGCTAGCATTTGAGGG No data
1026499946_1026499955 10 Left 1026499946 7:70935629-70935651 CCTGCCCCCTCTTCCTTATTCAG No data
Right 1026499955 7:70935662-70935684 CTAGCATTTGAGGGTGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026499946 Original CRISPR CTGAATAAGGAAGAGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr