ID: 1026509345

View in Genome Browser
Species Human (GRCh38)
Location 7:71015586-71015608
Sequence ATGGATATTAAGAAGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026509338_1026509345 16 Left 1026509338 7:71015547-71015569 CCAGGAGAGGAGAGAAAAGGAAG No data
Right 1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026509345 Original CRISPR ATGGATATTAAGAAGCAGAA GGG Intergenic
No off target data available for this crispr