ID: 1026509790

View in Genome Browser
Species Human (GRCh38)
Location 7:71018444-71018466
Sequence CTGCAGTCCTATGGCAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026509787_1026509790 4 Left 1026509787 7:71018417-71018439 CCTGGGATGGAGCTGCAGCCATC No data
Right 1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG No data
1026509782_1026509790 23 Left 1026509782 7:71018398-71018420 CCTAGGAGTTCGAAACCAGCCTG 0: 166
1: 5346
2: 29070
3: 35933
4: 25969
Right 1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG No data
1026509786_1026509790 8 Left 1026509786 7:71018413-71018435 CCAGCCTGGGATGGAGCTGCAGC No data
Right 1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026509790 Original CRISPR CTGCAGTCCTATGGCAATAC AGG Intergenic
No off target data available for this crispr