ID: 1026509954

View in Genome Browser
Species Human (GRCh38)
Location 7:71019484-71019506
Sequence CACTGGGAACAGAGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026509954_1026509963 17 Left 1026509954 7:71019484-71019506 CCATCTCCCCTCTGTTCCCAGTG No data
Right 1026509963 7:71019524-71019546 ACCTAGGCAAGGCTTGATGCTGG No data
1026509954_1026509961 6 Left 1026509954 7:71019484-71019506 CCATCTCCCCTCTGTTCCCAGTG No data
Right 1026509961 7:71019513-71019535 TTCCTGCTAAGACCTAGGCAAGG No data
1026509954_1026509960 1 Left 1026509954 7:71019484-71019506 CCATCTCCCCTCTGTTCCCAGTG No data
Right 1026509960 7:71019508-71019530 TGCAATTCCTGCTAAGACCTAGG No data
1026509954_1026509965 18 Left 1026509954 7:71019484-71019506 CCATCTCCCCTCTGTTCCCAGTG No data
Right 1026509965 7:71019525-71019547 CCTAGGCAAGGCTTGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026509954 Original CRISPR CACTGGGAACAGAGGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr