ID: 1026510971

View in Genome Browser
Species Human (GRCh38)
Location 7:71027193-71027215
Sequence CCCCATGACCACAGGTAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026510967_1026510971 -7 Left 1026510967 7:71027177-71027199 CCCTGCACTCACTGGGCCCCATG No data
Right 1026510971 7:71027193-71027215 CCCCATGACCACAGGTAGCCCGG No data
1026510966_1026510971 -4 Left 1026510966 7:71027174-71027196 CCTCCCTGCACTCACTGGGCCCC No data
Right 1026510971 7:71027193-71027215 CCCCATGACCACAGGTAGCCCGG No data
1026510962_1026510971 30 Left 1026510962 7:71027140-71027162 CCAAATCGTGGGGGTCTTGGCTC No data
Right 1026510971 7:71027193-71027215 CCCCATGACCACAGGTAGCCCGG No data
1026510968_1026510971 -8 Left 1026510968 7:71027178-71027200 CCTGCACTCACTGGGCCCCATGA No data
Right 1026510971 7:71027193-71027215 CCCCATGACCACAGGTAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026510971 Original CRISPR CCCCATGACCACAGGTAGCC CGG Intergenic
No off target data available for this crispr