ID: 1026511910

View in Genome Browser
Species Human (GRCh38)
Location 7:71034412-71034434
Sequence AACTGAAGCCTGCTACTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026511910_1026511916 28 Left 1026511910 7:71034412-71034434 CCCTTGAGTAGCAGGCTTCAGTT No data
Right 1026511916 7:71034463-71034485 TAGCCAATCACATCTTCCTGTGG No data
1026511910_1026511917 29 Left 1026511910 7:71034412-71034434 CCCTTGAGTAGCAGGCTTCAGTT No data
Right 1026511917 7:71034464-71034486 AGCCAATCACATCTTCCTGTGGG No data
1026511910_1026511912 -7 Left 1026511910 7:71034412-71034434 CCCTTGAGTAGCAGGCTTCAGTT No data
Right 1026511912 7:71034428-71034450 TTCAGTTCCCTGCCAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026511910 Original CRISPR AACTGAAGCCTGCTACTCAA GGG (reversed) Intergenic
No off target data available for this crispr