ID: 1026523403

View in Genome Browser
Species Human (GRCh38)
Location 7:71134782-71134804
Sequence CAGGCTTTTCTCAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026523395_1026523403 14 Left 1026523395 7:71134745-71134767 CCATAGGAACTTCAAAGGTTAAC 0: 1
1: 0
2: 4
3: 6
4: 120
Right 1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG 0: 1
1: 0
2: 2
3: 31
4: 256
1026523398_1026523403 -8 Left 1026523398 7:71134767-71134789 CCTGGTTTCCCTCATCAGGCTTT 0: 1
1: 0
2: 4
3: 17
4: 179
Right 1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG 0: 1
1: 0
2: 2
3: 31
4: 256
1026523391_1026523403 30 Left 1026523391 7:71134729-71134751 CCTGCTGTAGACATACCCATAGG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG 0: 1
1: 0
2: 2
3: 31
4: 256
1026523394_1026523403 15 Left 1026523394 7:71134744-71134766 CCCATAGGAACTTCAAAGGTTAA 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG 0: 1
1: 0
2: 2
3: 31
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026523403 Original CRISPR CAGGCTTTTCTCAGGGACAC AGG Intronic
900472519 1:2861818-2861840 CAGGCTTTTCGCAGGGAGAGTGG - Intergenic
900564385 1:3325149-3325171 CAGGTCCTTCTGAGGGACACAGG + Intronic
902603494 1:17555945-17555967 AAGGCTCTTCCCAGGGACGCTGG + Intronic
902938103 1:19779327-19779349 CAGACTTTTCTCAGGGAGAATGG - Intronic
902979247 1:20111246-20111268 AAGTCTTCTCTCAGTGACACTGG - Intergenic
903055029 1:20629981-20630003 CATGCATTTCCCAGGGACAATGG - Intergenic
903943331 1:26946419-26946441 CTGGCCTTTCTCTGGGGCACAGG + Exonic
904039990 1:27578070-27578092 CAGGCTTTTCTTTGGGACCAGGG - Intronic
905204913 1:36337900-36337922 CTGGCTCTTCCCAGGGACACTGG + Intergenic
906516334 1:46440925-46440947 CAGGATCTTCCCAGGGACAGAGG - Intergenic
909397460 1:75186523-75186545 CAGCCTTTTATCATGGATACAGG - Intergenic
910250112 1:85188478-85188500 AAACCTTTTCTCAGGGACATAGG - Intronic
911269483 1:95782843-95782865 CAGGCTTTTCTAGGTGACAGAGG - Intergenic
911951415 1:104177780-104177802 CAGGGTGTTCTCAAGAACACTGG - Intergenic
912756986 1:112332867-112332889 CAGGCTTCTCTCAGGGGAGCTGG + Intergenic
915754900 1:158250100-158250122 CTTGCTTTTGCCAGGGACACAGG - Intergenic
915903652 1:159863084-159863106 CAGGCCTTTCAAAGGGACTCAGG + Intronic
918093396 1:181316157-181316179 CAGGCTCTTCTCAAGGGCTCAGG + Intergenic
919045032 1:192440661-192440683 GATGCCTTTCTCAGGGACTCAGG - Intergenic
920061672 1:203231080-203231102 CAGAGCTTTCTCAGGGACCCTGG - Intronic
920115644 1:203619171-203619193 CAGGTTTTTCCCATGAACACAGG + Intergenic
920927300 1:210354035-210354057 CAGGCTGTTCTCAGGAAGGCTGG + Intronic
921525826 1:216216604-216216626 CAGGCATTTCTTAGGGATTCTGG + Intronic
921608640 1:217184494-217184516 CAGGAATTTCTCAGGGACTGAGG + Intergenic
922089842 1:222385388-222385410 CAGGGTTTTGCCAGGGGCACTGG - Intergenic
922975069 1:229777663-229777685 CTGTCTTTTCTATGGGACACCGG + Intergenic
922999975 1:229999027-229999049 CAGGCCTCTTTCAGGGAAACTGG - Intergenic
923139218 1:231147217-231147239 CCAGGTTTTCTCTGGGACACTGG - Intergenic
923139304 1:231147656-231147678 CTGGGTTTTCTCTGGGACACTGG + Intergenic
924254206 1:242166115-242166137 CTGGGTTTTCCCTGGGACACTGG + Intronic
924629011 1:245719755-245719777 CAGGCTTTTCTGAAGGAAAGAGG - Intergenic
1063393739 10:5666957-5666979 CATGCTTTGCAAAGGGACACAGG - Intergenic
1066998871 10:42587715-42587737 CAGGCCATGCTCAGGCACACTGG + Intronic
1067030820 10:42878083-42878105 CAAGCTTTTCTCAGGGCCTAGGG + Intergenic
1067044501 10:42976634-42976656 CACGCTGTTCTCAGGCACATGGG - Intergenic
1067919868 10:50443210-50443232 CAGGCTTTTCTTTGGAAAACAGG - Intronic
1068041326 10:51828405-51828427 CAGTCTTTGCTCAGTAACACAGG - Intronic
1069408390 10:68126881-68126903 CAGGCTTTTCTCAGTGTCCAGGG - Intronic
1070790916 10:79188815-79188837 CTGGCTTTTCTCAGTGTTACTGG - Intronic
1070845238 10:79516934-79516956 CACCCTCTTCTCAGGGAAACGGG - Intergenic
1070965001 10:80524493-80524515 CAGGTTTTTCTCAGGGCACCAGG - Exonic
1073446856 10:103586066-103586088 CTGCCTTTTCTCGGGGGCACAGG + Intronic
1074439238 10:113460640-113460662 CAGCCTTTACCCAGGGAGACAGG + Intergenic
1075967079 10:126622371-126622393 GAGGCTTTTTTCTGGGTCACAGG - Intronic
1077216298 11:1396532-1396554 CAGGCTGTTCCCAGGGACTGGGG - Intronic
1081660592 11:44885728-44885750 CAGGCTTTTCTCAGCCACGCAGG + Intronic
1081868435 11:46372284-46372306 CAGGATTTTCTCAGGATCCCTGG - Intronic
1083592617 11:63904411-63904433 CAGGGTTTCCTTAGGGACCCCGG + Intronic
1084734544 11:71095956-71095978 CATGCTTTTCACATGGAGACAGG - Intronic
1087210905 11:95445995-95446017 CAAGTTTTGCTCAGGAACACAGG + Intergenic
1087866596 11:103235756-103235778 CAGGTTTTTCTCAGAGATTCAGG - Exonic
1089157894 11:116416035-116416057 CATGCTGTTCTCAGGAGCACAGG - Intergenic
1090351374 11:126110617-126110639 CAGGCTTTGCTCAGGGAGGCTGG - Intergenic
1090444344 11:126750521-126750543 TAGGCTTTTCTTAGGGCAACTGG + Intronic
1091277107 11:134360092-134360114 CAGGCTGTGCTCAGGGGCCCAGG + Intronic
1093342788 12:17998706-17998728 CAGGCTGACCTCAGTGACACAGG + Intergenic
1093387330 12:18573897-18573919 TAGGCTATTCTCAGAGCCACTGG - Intronic
1096885852 12:54718429-54718451 CAAGCCAATCTCAGGGACACGGG - Intergenic
1100613077 12:96208442-96208464 CATGCTCTTCTCAGGAAAACTGG - Intronic
1102506517 12:113387766-113387788 CAGGCTTTGCACAGTGACAGAGG - Exonic
1103701865 12:122852282-122852304 CAGGCTCTTCCCAGGCACAAGGG - Intronic
1103722649 12:122982803-122982825 CAGTCTCTTCTCAGGGGCAGGGG + Exonic
1104746913 12:131216303-131216325 CAGACATTTATCAGGGACCCTGG - Intergenic
1104785282 12:131444742-131444764 GAGGGCTTTCCCAGGGACACCGG - Intergenic
1104785706 12:131446880-131446902 CAGACATTTATCAGGGACCCTGG + Intergenic
1105603064 13:21904131-21904153 CTGTCGTTTCTCAGGGACCCTGG + Intergenic
1105609216 13:21953308-21953330 CAGGCTTTTCACAGGAGCCCAGG - Intergenic
1105821873 13:24087268-24087290 CAGGCTTTGCTCAGGAACTCAGG - Intronic
1106936084 13:34721838-34721860 CAGGCTTTACCCAGAGACAAAGG + Intergenic
1107632003 13:42351740-42351762 CAGGCTAGCCTCAGGCACACTGG - Intergenic
1107958656 13:45540674-45540696 CAGTATTTTCTCAAGGACACTGG - Intronic
1111865226 13:93759811-93759833 TAGGCTGTTCTTGGGGACACAGG + Intronic
1112192613 13:97192629-97192651 CAGCCTTTTCTCAGGATCATGGG - Intergenic
1112792031 13:103013894-103013916 CAGGCCTTGCTGAGGGACAAGGG - Intergenic
1113171624 13:107511121-107511143 AAGGCTGTTCACAGTGACACCGG + Intronic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1116298252 14:43140777-43140799 CAGGACTTTCTCAAGGACCCAGG - Intergenic
1118613011 14:67555943-67555965 CAGGCCCTTCCCACGGACACAGG + Intronic
1120204487 14:81573280-81573302 CATGGTTTTCTCTGGGACCCAGG - Intergenic
1121671318 14:95712565-95712587 CATGCTCCTCTCAGGGACTCTGG + Intronic
1122920177 14:104876704-104876726 CAGGCTGCTCTCAGGGAGAGTGG + Intronic
1123203671 14:106691981-106692003 CAGGCTGTTCTCAGGGTAACAGG - Intergenic
1123458330 15:20445288-20445310 CTGGCTTTTCTCAGCCACGCTGG - Intergenic
1123659736 15:22555121-22555143 CTGGCTTTTCTCAGCCACGCTGG + Intergenic
1124264621 15:28221457-28221479 CTGGCTTTTCTCAGCCACGCTGG - Intronic
1124313597 15:28649616-28649638 CTGGCTTTTCTCAGCCACGCTGG + Intergenic
1124403669 15:29375065-29375087 CAAACTTTGCTCTGGGACACAGG + Intronic
1126426737 15:48535656-48535678 CTGACTTTTCTCAAGAACACAGG - Intronic
1127752768 15:62062015-62062037 CAGTCTATTCTCATGAACACCGG + Intergenic
1128980297 15:72180642-72180664 CAGGCTCTTCTCAGGACCACAGG + Intronic
1129604436 15:77017979-77018001 CTGGCTTTACACAGGCACACAGG - Intronic
1130430486 15:83842281-83842303 CTGCCTTTTCTCAAGGACAGAGG - Intronic
1134019636 16:10912595-10912617 CTGGCTTTTTTCTGGGGCACAGG - Intronic
1135252098 16:20909167-20909189 CAGCCTTTTCTTAGTGGCACAGG + Intronic
1139936943 16:70578356-70578378 CAGGTTTTCCTGAGGGACACAGG - Intergenic
1140217779 16:73022311-73022333 CAGGCCTGACTCAGGGAGACGGG - Intronic
1141589713 16:85060383-85060405 CAGGCCTCCCTCAGAGACACAGG + Intronic
1142284267 16:89165372-89165394 CAGGCTACCTTCAGGGACACTGG + Intergenic
1143513352 17:7407634-7407656 CAGGTTCTCCTCAGGGACTCAGG - Intronic
1143773875 17:9185378-9185400 CAAGCTTTTCTCAGGCAGCCTGG - Intronic
1144449214 17:15361686-15361708 CAGTCTTTTCTTGGGGACTCTGG - Intergenic
1144836103 17:18157532-18157554 AGGGATTTTCTCAGGGCCACAGG - Intronic
1146377505 17:32304421-32304443 CAGGCTTTGGTCAAGAACACGGG + Intronic
1146559022 17:33852019-33852041 CAGGCTGTACTCAGTGACTCAGG + Intronic
1147587268 17:41659711-41659733 CAAGGTTGTCACAGGGACACAGG + Intergenic
1147793583 17:43027655-43027677 CTGGCTTTTGTCATGGAAACTGG - Intronic
1148897310 17:50846316-50846338 TAGGGTTTTCTCAAGGACCCTGG + Intergenic
1148964050 17:51419737-51419759 AAGGCTTTCTTCAGGGCCACAGG - Intergenic
1150580983 17:66473501-66473523 AAGGCTGTTCTGAGGGACTCTGG - Intronic
1150655006 17:67033584-67033606 CTGGCTTTTATCTGGGTCACTGG + Intergenic
1151788838 17:76290891-76290913 CATGCTGTTTTCAGGGACTCAGG + Intronic
1151855748 17:76720573-76720595 CAGGTGTTTCTGAGAGACACAGG - Intronic
1152175080 17:78782094-78782116 CTGGCGTTTCCCGGGGACACTGG - Intronic
1152377305 17:79925477-79925499 CAGGGTTTTCTCAGGAGCCCGGG + Intergenic
1153365452 18:4250421-4250443 CAGGACTTTCTCAGGTACAGAGG - Intronic
1153630163 18:7061864-7061886 CAGGCTGTTCTCAGACGCACAGG - Intronic
1153776718 18:8460941-8460963 TAGGCATTTCCCAGGGACACAGG + Intergenic
1153966856 18:10190177-10190199 ATGGGTGTTCTCAGGGACACAGG + Intergenic
1154437532 18:14358131-14358153 CAGGCTGTGCTAAGGGACAGTGG - Intergenic
1155618885 18:27753130-27753152 CATGATTTTCTATGGGACACAGG - Intergenic
1156455711 18:37292522-37292544 CTGGCTTTTCTCCCTGACACCGG + Intronic
1158250497 18:55482183-55482205 CAGGCTTCTCTCATGGTCATAGG + Intronic
1158305772 18:56103668-56103690 CAGGCATTTCTCAGACACCCTGG - Intergenic
1158718837 18:59905248-59905270 GAGGCTTTTCTCTGGGAAAGTGG + Intergenic
1158850687 18:61493320-61493342 GAGTCTTTTCACAGGGAGACAGG - Intronic
1160130159 18:76218326-76218348 CAGGCTTTTCTCTGGGACCCGGG - Intergenic
1160173243 18:76571833-76571855 CAAGCTATTATCAGGGAAACAGG - Intergenic
1161068665 19:2250045-2250067 CAGCCTGTTCTCAGGGCCGCTGG + Intronic
1163126078 19:15244865-15244887 CTGCCCTTTCTCAGGGTCACTGG - Intronic
1164586286 19:29478147-29478169 CAGGCTTCTTCCAGGGATACAGG + Intergenic
1164647654 19:29871548-29871570 CAGCTTTTTCTCAGGGTCTCAGG - Intergenic
1164698640 19:30265752-30265774 CAGGCTGGCCTTAGGGACACGGG + Intronic
1165272256 19:34720716-34720738 CAGGTTCTTCACATGGACACAGG - Intergenic
1166351571 19:42201228-42201250 GAGCCTTCTCTCAGGGACATAGG - Intronic
925023139 2:587607-587629 CAGCCTTTCCTCAGGGCCACAGG + Intergenic
926166429 2:10524181-10524203 GAGGGTTGTCTCAGGGAAACAGG + Intergenic
928073630 2:28242442-28242464 CAGGCTTTGCTCAGTGAGACAGG + Intronic
929867701 2:45732246-45732268 CAGACATGTCTCAGGGACTCAGG + Intronic
931754830 2:65363477-65363499 CTGGCTTTTCTGAGCTACACAGG + Intronic
932396603 2:71453390-71453412 CAGGCTTCTCTTAGGGAAAGAGG + Intergenic
932447551 2:71790283-71790305 CAGGCTGTGGTCATGGACACAGG - Intergenic
932593911 2:73082661-73082683 CAGGGGCTTCTCAGGGACTCTGG + Intronic
935656893 2:105430796-105430818 CAGTCTTTTCTCCCAGACACAGG - Intronic
940151832 2:150610938-150610960 TATGCTTTTCTCAGGTACCCAGG + Intergenic
940235898 2:151510373-151510395 CAGCCTTTGTACAGGGACACTGG + Intronic
945201939 2:207290586-207290608 CAGGTATTTCTCAGAGTCACTGG - Intergenic
945228737 2:207561139-207561161 AAGACTTTTCTCCGGAACACAGG + Exonic
947246739 2:228056867-228056889 CAGGCTACTCTCAGGAACACTGG - Intronic
948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG + Intergenic
1168859572 20:1036529-1036551 CAGGACTTTCTCATGCACACTGG - Intergenic
1169613158 20:7406902-7406924 TAGGCTTTTCTCAGAGAGAATGG - Intergenic
1169669925 20:8086599-8086621 CATGCATTTCTGAGGGATACTGG + Intergenic
1173020579 20:39264667-39264689 CAGGCTTTTCTGTGGGATGCAGG - Intergenic
1173673038 20:44810830-44810852 CAGGCCTCTCCCAGAGACACTGG + Intergenic
1175768578 20:61608109-61608131 CAGGATCTTCTCAGAAACACAGG - Intronic
1175792117 20:61746278-61746300 CAGTCATGTCTCAGGGACTCAGG - Intronic
1177083102 21:16666690-16666712 GAGGCTTTTCTTAGAGACCCTGG + Intergenic
1178808428 21:35859115-35859137 CAGGGTTTGCTCACGGATACAGG + Intronic
1181466939 22:23115443-23115465 TAGGCAGTCCTCAGGGACACTGG - Intronic
1181844909 22:25699265-25699287 CTGTCTTTTCTCAGGCACACGGG + Intronic
1183435589 22:37792698-37792720 CAGGCATTGGTGAGGGACACAGG - Intergenic
1183984488 22:41562021-41562043 CAGGCTCTTCCCAGGGAGAGGGG + Intronic
1184645769 22:45894253-45894275 CAGGATGTTCCCAAGGACACAGG - Intergenic
1184688561 22:46107332-46107354 CGGGCTTGGCTCAGGGCCACTGG - Intronic
1185246598 22:49776272-49776294 CAGGCCTTTCTCAGCCACCCCGG + Intronic
949168518 3:970016-970038 CAGGCTATTCTCACAGAGACTGG + Intergenic
949275477 3:2274823-2274845 CAGCCTTATCACAGGGACATGGG - Intronic
950357644 3:12425326-12425348 CAGGTTTTTCTGAGAGACATTGG + Intronic
950510719 3:13424766-13424788 CAGGCTTTGGTCATGGACTCTGG + Intergenic
951531504 3:23702485-23702507 TAGGCTTGTCTCAGCTACACAGG - Intergenic
952729646 3:36625472-36625494 AAGGCTTTTCTCAGGATCACAGG - Intergenic
952953560 3:38542982-38543004 CAGGACTTTCCCAGGGACAGAGG - Intergenic
952991881 3:38837411-38837433 CAGCCTTTTCTCAGAGCCACTGG - Intergenic
954292134 3:49655318-49655340 CATGCTCTTCTCAGGCACACTGG - Exonic
954817081 3:53291147-53291169 CTGGCTTTTATAAGAGACACAGG - Intronic
956731718 3:72202540-72202562 CAGGAGTTTCCCAGGGACAGGGG - Intergenic
961906140 3:130264603-130264625 CTGGCTTTTCCCAGGGATGCTGG - Intergenic
962473146 3:135731580-135731602 CAGGCATTTCCCAGGACCACAGG + Intergenic
962606594 3:137037378-137037400 CAGGCTTGTCAGACGGACACTGG - Intergenic
963085222 3:141429867-141429889 CTGCCTTTGCTCAGGCACACAGG - Intronic
963229787 3:142897870-142897892 GAGCTTTTTCTCAGAGACACTGG + Intergenic
965463430 3:168997704-168997726 CAGGATTTTCCCAGGGAGAGAGG - Intergenic
965727352 3:171732316-171732338 AAGGGTTTTCTCAGGAAAACAGG - Intronic
966413085 3:179663375-179663397 CAGTCATCTGTCAGGGACACTGG + Intronic
968698832 4:2045288-2045310 CAGGCTTGGCTGTGGGACACTGG + Intergenic
968763027 4:2452054-2452076 CAGGTTTTCCTGAGGGACAGTGG - Intronic
969289729 4:6230922-6230944 CAGTCTTCTCTGAGGGGCACAGG + Intergenic
969639326 4:8387631-8387653 AAGGCATTTGACAGGGACACGGG + Intronic
969669046 4:8579738-8579760 CAGCCCTTTCTGAGGGACAAAGG - Intronic
970763734 4:19521684-19521706 CAGACTATTCTGAGGGACAAAGG + Intergenic
975417026 4:74116538-74116560 CAGGCTTTTTTCAGGGCCTTGGG - Intronic
975985905 4:80201756-80201778 CATTCTTTTCTCAGGCACTCAGG + Intronic
977300772 4:95264819-95264841 GAGGCTTTTCAGAGGGACAGTGG - Intronic
977811299 4:101358660-101358682 CAGTCTTTTCTCTGGAAAACAGG + Intergenic
978161108 4:105549539-105549561 TGGTCTTTTCTCATGGACACAGG + Intergenic
978803458 4:112776762-112776784 TAGGCATCTATCAGGGACACAGG + Intergenic
979743465 4:124179967-124179989 CCGGCTTTTTTCTGAGACACAGG + Intergenic
981240859 4:142474433-142474455 CAGGATTTTCTCAGGACAACAGG - Intronic
981689096 4:147486609-147486631 CTGGCTTTTCTCAGTGATATGGG + Intronic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
982966856 4:161920118-161920140 ATGGATTTTCTTAGGGACACAGG - Intronic
985573215 5:661875-661897 CAGGCTTTTCTCAGACATGCGGG - Exonic
986163354 5:5251022-5251044 CAGGCTTGGCTCAAGGACACTGG - Intronic
986637147 5:9834628-9834650 CAGACGTTCCCCAGGGACACAGG + Intergenic
987398008 5:17443708-17443730 CTGGCTTATCTCAAGGACAGAGG - Intergenic
988710047 5:33763928-33763950 CAGACTTTTCATAGGGAAACAGG + Intronic
993292686 5:86095639-86095661 CAGGCCTTGCTCAGCCACACTGG + Intergenic
994055209 5:95406735-95406757 CAGGATTTTGTAAGGGAGACAGG + Intronic
995355079 5:111227965-111227987 AAGGCTTTTCTGAGGGAGAAGGG + Intronic
997426528 5:133806698-133806720 CAGGCAGTTCTCAGGGGCAGGGG - Intergenic
998176321 5:139904257-139904279 CAGGTTTCTCCCAGGGAAACCGG + Intronic
998874865 5:146588977-146588999 CCAGCCTTTCTCAGGGACTCAGG + Intronic
1000048496 5:157541529-157541551 CAGGTTTTGCTCAGGGACTTTGG - Intronic
1001215633 5:169853294-169853316 CAGGATTTTCCCAGGGGCAGTGG - Intronic
1002055902 5:176597751-176597773 TCGGCTTTCCCCAGGGACACAGG + Exonic
1002055965 5:176598039-176598061 TCTGCTTTTCCCAGGGACACGGG + Exonic
1003347872 6:5287506-5287528 CAGGCTAATTTCAGGGACACGGG - Intronic
1004475351 6:15966374-15966396 CTGTCTTTTTTCAGGGAAACTGG - Intergenic
1005750774 6:28880425-28880447 TAGGCTTTGCTCAGGAACCCAGG - Intergenic
1006844125 6:37050887-37050909 CAGGCTTCTCTCTGGGACTGGGG + Intergenic
1006945663 6:37783151-37783173 GAGTCTTTGCTCAGGGACAGGGG + Intergenic
1009841716 6:69085307-69085329 TAGACTGTTCTCAGGGACTCTGG + Intronic
1011805377 6:91066680-91066702 GAGGCATTTCTCTGGGACACTGG + Intergenic
1012270068 6:97198162-97198184 CAGGGTATTCTCAGGGTCATTGG - Intronic
1012555123 6:100502219-100502241 CAGGCTTCTCTCAGAGTCATTGG - Intergenic
1012977674 6:105797388-105797410 CAGGTTTGCCTGAGGGACACAGG + Intergenic
1014217927 6:118770648-118770670 GATGCATTTCTCAGTGACACAGG - Intergenic
1015158314 6:130123838-130123860 AAGACGTTTCTCAGTGACACTGG + Intronic
1016837881 6:148497308-148497330 CAGTCTTTTCTCTGGGACAGGGG + Intronic
1016935585 6:149447075-149447097 CAGGCAGTTCCCAAGGACACAGG - Intergenic
1017971865 6:159318753-159318775 CTGGCTTGTCTCAGAGACAAGGG + Intergenic
1018928592 6:168224219-168224241 CAGGCTGTGCCCAGGGACAGTGG + Intergenic
1019470623 7:1218677-1218699 CAGGTTTGGCTCAGGGTCACTGG - Intergenic
1019546895 7:1582228-1582250 CAGGCTTCCCTCAGGAACAAAGG - Intergenic
1019642021 7:2108652-2108674 AAGGCTTTTCACAGGGAGCCAGG + Intronic
1019811059 7:3165431-3165453 CAGCCTTCTCTCATGGACAGAGG - Intronic
1019899788 7:4011214-4011236 CTGGCTTCCCTCAGGGAGACGGG + Intronic
1025212046 7:57025380-57025402 CAGGTTTTACCCAGGGCCACAGG + Intergenic
1025600590 7:62992797-62992819 CACCTTTTTCTCAGGGACAAGGG - Intergenic
1025659908 7:63551448-63551470 CAGGTTTTACCCAGGGCCACAGG - Intergenic
1026368492 7:69674118-69674140 CAGGCTTGTCCCAGACACACTGG - Intronic
1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG + Intronic
1027584480 7:80041206-80041228 CATGCTATTCTAAGGGAGACTGG - Intergenic
1028069841 7:86437600-86437622 CGTGCTTTTCTCACAGACACTGG + Intergenic
1028392459 7:90332675-90332697 CATTCTTTTTTCAGGAACACAGG + Intergenic
1030414593 7:109226736-109226758 CAGCCTTATCTCAGGAATACAGG - Intergenic
1034498206 7:151434209-151434231 CTGGCTCCTCTCAGGGACAGTGG + Intronic
1034933091 7:155179566-155179588 CAGGCTTCTCTTAGAGAGACAGG + Intergenic
1035297835 7:157877061-157877083 CAGGGTTTCCTCGGGGACCCCGG + Intronic
1035297848 7:157877100-157877122 CAGGGTTTCCTCGGGGACCCCGG + Intronic
1035297870 7:157877177-157877199 CAGGGTTTCCTCGGGGACCCCGG + Intronic
1035297883 7:157877215-157877237 CAGGGTTTTCTCGGGGACCCCGG + Intronic
1035297916 7:157877329-157877351 CAGGGTTTTCTCGGGGACCCCGG + Intronic
1035297933 7:157877405-157877427 CAGGGTTTCCTCAGGGACCTTGG + Intronic
1035662150 8:1356212-1356234 AAGGTTTTGCTCAGGGACATGGG + Intergenic
1036205910 8:6805668-6805690 CAGGCTTTTCTGAATGACTCAGG - Intergenic
1036234524 8:7026803-7026825 CAGCCTGGCCTCAGGGACACCGG + Intergenic
1036662121 8:10715412-10715434 CAGGCATCTCTCCCGGACACAGG + Intergenic
1036760456 8:11505387-11505409 CATGCTGTGCTCAGGGACAAGGG - Intronic
1038156832 8:24999418-24999440 CAACCTTTTCCTAGGGACACAGG + Intergenic
1038396356 8:27248404-27248426 CTGGGTTTACTCAGGAACACAGG + Intronic
1038860211 8:31379629-31379651 GAGACTTTTCTCAGGAACAGAGG - Intergenic
1042041104 8:64590272-64590294 TGGGCTTTTCTCAGAGACACTGG - Intronic
1044417721 8:91954936-91954958 CAGTCTATTCTCAGTCACACTGG - Intergenic
1044728255 8:95210051-95210073 CTGGGTCTTCTGAGGGACACAGG + Intergenic
1045120766 8:99031767-99031789 CAGCCATTTCTCAGGGACTAAGG - Intronic
1047245854 8:123143760-123143782 GAGGCTGTTCTCAGGAAAACAGG + Intronic
1048217067 8:132506112-132506134 CAGGTTTTCCTCAGGCAAACTGG - Intergenic
1049323919 8:142012001-142012023 CAGGCTTGTCCCATTGACACAGG - Intergenic
1050602185 9:7264194-7264216 CAGGCTTTCCCTAGGGAAACAGG + Intergenic
1050909772 9:11054274-11054296 CAGGCTTTGAGCAGGGATACAGG + Intergenic
1053579662 9:39391434-39391456 CAGGCTTTTGTCAAGGCCACAGG - Intergenic
1053844180 9:42219515-42219537 CAGGCTTTTGTCAAGGCCACAGG - Intergenic
1054101249 9:60950243-60950265 CAGGCTTTTGTCAAGGCCACAGG - Intergenic
1054122622 9:61225606-61225628 CAGGCTTTTGTCAAGGCCACAGG - Intergenic
1054585101 9:66956637-66956659 CAGGCTTTTGTCAAGGCCACAGG + Intergenic
1056687758 9:88780459-88780481 CAGGTTGTTCTTGGGGACACTGG - Intergenic
1059281773 9:113140504-113140526 CAGTCTAATCTCAGAGACACTGG + Intergenic
1061165869 9:128921949-128921971 CAGGCGTTCCTCAGAGTCACAGG + Exonic
1062116720 9:134813606-134813628 CACGCAGTCCTCAGGGACACAGG - Intronic
1190389578 X:49918743-49918765 CAGGCATTTCTTAGGCACTCGGG + Intergenic
1190617638 X:52252483-52252505 CATGCCTTTATCTGGGACACTGG - Intergenic
1190911341 X:54774955-54774977 CAGGCTCTGCCCAGGGCCACAGG + Intronic
1190919882 X:54841260-54841282 CAGGCTCTGCCCAGGGCCACAGG - Intergenic
1192664652 X:73076812-73076834 CAGTATTTTCTCAGGGACACAGG - Intergenic
1195614234 X:106900279-106900301 CAGGCTTTCCACAGAGAGACGGG + Exonic
1198833907 X:140781284-140781306 TAGGCTCTTCTCAGGCACCCTGG - Intergenic
1202372682 Y:24209305-24209327 CAGGGTCTTCTGAGGGACCCAGG - Intergenic
1202498100 Y:25460815-25460837 CAGGGTCTTCTGAGGGACCCAGG + Intergenic