ID: 1026525048

View in Genome Browser
Species Human (GRCh38)
Location 7:71146221-71146243
Sequence GGGCTGCGGTGGTGGCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 352}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026525048_1026525053 -10 Left 1026525048 7:71146221-71146243 CCCGGGTGCCACCACCGCAGCCC 0: 1
1: 0
2: 0
3: 25
4: 352
Right 1026525053 7:71146234-71146256 ACCGCAGCCCACTTCTTACTGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026525048 Original CRISPR GGGCTGCGGTGGTGGCACCC GGG (reversed) Intronic
900288982 1:1915866-1915888 GGGCTGTGTTGGTGGCAGCAGGG - Intronic
900620334 1:3584119-3584141 GTCCTGCGCCGGTGGCACCCTGG - Intronic
901056021 1:6448951-6448973 GGGCGGCGGTGGCAGCTCCCTGG - Exonic
901078616 1:6571167-6571189 GGGCGGCTGTGGTGGCAGCACGG - Exonic
901096233 1:6682482-6682504 GGGCAGCGGTGCTGGGGCCCGGG + Intronic
901237595 1:7675842-7675864 GGGCTGCTGGGCTGGGACCCCGG + Intronic
902067606 1:13700643-13700665 GGGCGGCGGTGGGGCCACCTGGG + Intronic
902242966 1:15100956-15100978 GGGATGCTGTGGAGGCCCCCAGG + Intronic
902269593 1:15293960-15293982 AGGCTGCAGTGGTGACGCCCAGG - Intronic
903944253 1:26951837-26951859 GGGCTGGGGAGGTGGCCCTCGGG + Exonic
904368680 1:30034850-30034872 GGGGTGGGGTGGTGCCACACGGG - Intergenic
904624431 1:31794083-31794105 GGGGTGCAGGGGTGGCAGCCAGG - Intronic
905239133 1:36571207-36571229 GGGCTGAGGTGGTGACAGCTAGG - Intergenic
905930596 1:41784146-41784168 GGGCAGGGGAGGTGGGACCCTGG - Intronic
912386375 1:109273099-109273121 GGACTGGGGTGGTGGCCTCCTGG + Intronic
914226114 1:145720945-145720967 GAGCTGCGCTGGTGGCCCCAGGG - Intronic
915731409 1:158056781-158056803 GGGCGGGGGTGCTGGCAGCCTGG + Intronic
916063887 1:161120706-161120728 GGCCTGCGGTGCTGGAACACAGG - Exonic
916359162 1:163948678-163948700 GGACTGGGGTGCTGACACCCAGG + Intergenic
916810965 1:168305231-168305253 GGGCTGGGGTGGGGGCAGTCAGG + Intronic
918164979 1:181936429-181936451 GTGGTGCGGAGGTGACACCCTGG - Intergenic
920193951 1:204213741-204213763 GAGATGCTGTGCTGGCACCCTGG - Intronic
920795305 1:209131108-209131130 GGGCAGCGGTGGTGGCGGGCGGG + Intergenic
921094518 1:211874923-211874945 GGACTGGGGTGGTGGAAGCCAGG - Intergenic
922810771 1:228414506-228414528 GGGCTGGGGAGGAGGCATCCAGG - Intronic
924246163 1:242087191-242087213 GGGCAGCGGTGGTGACTCCATGG - Exonic
924386201 1:243499879-243499901 AGGCTGAGGCGGTGTCACCCTGG - Exonic
1063141883 10:3263073-3263095 GGGCTGGGGTGATGGCTTCCCGG - Intergenic
1063365644 10:5488718-5488740 GGTCAGCGGTGGGGGCGCCCAGG - Intergenic
1063450067 10:6145126-6145148 GGGCTGCGGCGGTGCCGCCCGGG + Intronic
1063551817 10:7040949-7040971 GTGCTGCTGCGGTGGCGCCCGGG + Intergenic
1063716237 10:8529909-8529931 AGGCTGCAGTGGTGCAACCCTGG - Intergenic
1064264620 10:13815388-13815410 GGGCTGAGGTGGTGGCAGATGGG + Intronic
1065214874 10:23439502-23439524 GGGCGGCGGCCGTGGGACCCGGG - Exonic
1065390187 10:25175067-25175089 GAGCGGCGGTGGCGGCAGCCGGG + Exonic
1065916903 10:30360319-30360341 GGGATGGGGTCGTGGCTCCCTGG - Intronic
1066057858 10:31698183-31698205 GGGCTGTGCTGGTGCCACTCAGG + Intergenic
1066746008 10:38604597-38604619 GGGGTCAGGTGGAGGCACCCTGG - Intergenic
1067808719 10:49410606-49410628 GGGCTGGGCTGGGAGCACCCGGG - Intergenic
1070880271 10:79848594-79848616 GGGCTGGGGTGGTGGCCGGCGGG - Exonic
1072613438 10:97034435-97034457 GGGCTGGGGTGGGGGGCCCCGGG - Intronic
1075791025 10:125084551-125084573 GGGCTGGGGAGGTGGCTTCCAGG - Intronic
1076096328 10:127737171-127737193 GGGCCGGGCTGGTCGCACCCGGG + Intergenic
1076697863 10:132255802-132255824 GGGCCATGGTGCTGGCACCCAGG - Intronic
1076774339 10:132686101-132686123 GGGCTGCACTGGTGGGACCCTGG - Intronic
1076780698 10:132722962-132722984 GGGCAGCGGGGCTGGCACTCAGG + Intronic
1076849179 10:133084667-133084689 GGGCTGCGGTGGTCGGCCCTGGG + Intronic
1076902722 10:133347783-133347805 GCCCTGAGGTGGTGTCACCCTGG + Intronic
1077077880 11:709437-709459 GGGCTCACTTGGTGGCACCCGGG - Exonic
1077176627 11:1194058-1194080 TGGCTCGGGTGGTGGCACCATGG - Intronic
1077218123 11:1403530-1403552 GGGCTGCGGAGGAGGGGCCCAGG + Intronic
1077228251 11:1447589-1447611 GGGCTGGGGTGGGGGCTACCAGG + Intronic
1077254554 11:1574423-1574445 GGACTAGGGAGGTGGCACCCTGG + Intergenic
1077322312 11:1947798-1947820 GCGCTGCGGTGGGGGCCGCCCGG - Intronic
1077350569 11:2091308-2091330 GGGCTGGGGAGCTGGCCCCCAGG + Intergenic
1077383973 11:2260386-2260408 GGGCTGAGGGGGTGGCTGCCAGG + Intergenic
1077391326 11:2301909-2301931 GGGCTGGGCTGGGGGCACCAGGG + Exonic
1077545776 11:3169109-3169131 GGGCTGCAGTGGGGAGACCCAGG + Intergenic
1077917122 11:6618725-6618747 GGGATGCGGTGGAGGGACACAGG - Intronic
1078538537 11:12194760-12194782 GGGCTCTGGTGCTGGTACCCTGG - Intronic
1079117222 11:17647517-17647539 GAGCTGGGGAGCTGGCACCCAGG + Intergenic
1081977130 11:47242812-47242834 GGGCAGCGGTGAGGGCAGCCAGG + Exonic
1082280613 11:50267858-50267880 GGGCGGCGGTGGCGGCTCCCGGG + Intergenic
1082997071 11:59263097-59263119 GGGCTGCTGTGGTGGAGACCTGG + Intergenic
1083299042 11:61730722-61730744 GGGCTGCGTTGGTGGGAGACTGG - Intronic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1084384395 11:68833681-68833703 GGAGTGCGGTGGTGGGACCTTGG - Intronic
1084775023 11:71369349-71369371 TGGCTGCTGTGGCGTCACCCAGG - Intergenic
1084911674 11:72394789-72394811 GTGCTGCGGTGCTGGCATTCTGG + Intronic
1084973031 11:72781697-72781719 CGGCGGCGGCGCTGGCACCCCGG - Intronic
1085408362 11:76277380-76277402 GGGCTGCAGTGGAGGCAGCCAGG - Intergenic
1085943896 11:81242337-81242359 GTGGTGGGGTGGAGGCACCCAGG - Intergenic
1086498426 11:87427237-87427259 GGGCTGGGCTGGGGGCACTCGGG + Intergenic
1086923758 11:92617765-92617787 AGGCTCCGCTGGTGACACCCGGG - Intronic
1087437929 11:98145712-98145734 GGGCTGCTGTGAAGACACCCTGG + Intergenic
1089370315 11:117950858-117950880 GAGCTACTGTGGTGGCACCTGGG + Intergenic
1090237483 11:125160148-125160170 GGGCTGTGGTGGGGGGAGCCAGG - Intergenic
1090466075 11:126934994-126935016 GGAGTGCAGTGGTGTCACCCCGG - Intronic
1090515630 11:127423623-127423645 GGCCTGTGGTGGTGGCCACCAGG - Intergenic
1202805330 11_KI270721v1_random:3111-3133 GCGCTGCGGTGGGGGCCGCCCGG - Intergenic
1091582534 12:1798034-1798056 CGCCTGCGGTGGGGGCAGCCGGG + Intronic
1092313340 12:7382857-7382879 GGGCTGCAGTGGTGCCATGCTGG + Intronic
1095752938 12:45730218-45730240 GGGCTGGGGGGGTGGCCCGCGGG + Intronic
1095954755 12:47799633-47799655 GAGCTGCCATGGAGGCACCCAGG - Intronic
1101340879 12:103841121-103841143 CGGCGGCGGTGGTGGCACGCGGG - Exonic
1101365349 12:104064973-104064995 GGGCTGGGGTGGGGGCGTCCGGG - Intronic
1101750879 12:107581417-107581439 GCGCTGGGGTGGAGGCTCCCTGG + Intronic
1101831096 12:108257253-108257275 GGGCTGTGGTGGTGGAAGCGAGG - Intergenic
1101922289 12:108942706-108942728 GGCCTGGGGTGGTAACACCCTGG + Intronic
1102508171 12:113397193-113397215 TGCCTGCGGTGGTGGCAGCGTGG + Exonic
1103328000 12:120134433-120134455 GGGTGGTGGTGGAGGCACCCAGG - Intronic
1103763831 12:123268550-123268572 GGGCTGCAGTGGCAGCATCCAGG - Intronic
1104730590 12:131103406-131103428 GGGCTGGGGTAGGGGCAGCCTGG - Intronic
1105004318 12:132711324-132711346 GCGCTCCGGCGATGGCACCCAGG - Intronic
1108498092 13:51044609-51044631 GTGCTGCCGTGGTGGCAGGCTGG + Intergenic
1113930763 13:113967752-113967774 GGGCTGGGGTGGGAGCAGCCCGG - Intergenic
1116835927 14:49768829-49768851 GGGCTGCTGTCATGTCACCCTGG + Intronic
1120953080 14:90060619-90060641 GGGCTGCGGTGCTCCCACCAGGG - Intergenic
1122228510 14:100293218-100293240 GGTCTGGGGTGGTGGCAGCCCGG + Intronic
1122236024 14:100330990-100331012 GGGCTGCTGTGGTGGAGACCCGG - Intergenic
1122314313 14:100816762-100816784 GGGCTGGGGAGGTGGAACTCTGG - Intergenic
1122875108 14:104660315-104660337 GGCCTGGGGCGGAGGCACCCAGG - Intergenic
1122929941 14:104928525-104928547 CTGCTGGGGTGGTGACACCCAGG - Intronic
1123699060 15:22901408-22901430 GGGGTGAGGTGGTGGCTGCCAGG - Intronic
1124489971 15:30149651-30149673 GGGATGGGGTCGTGGCTCCCTGG + Intergenic
1124520058 15:30399637-30399659 GGGATGGGGTCGTGGCTCCCTGG - Intergenic
1124618023 15:31256567-31256589 GGGCTGTGCTGGTGGCTGCCAGG + Intergenic
1124625348 15:31304431-31304453 TGGCTGGGGTGGCTGCACCCAGG + Intergenic
1124753561 15:32388676-32388698 GGGATGGGGTCGTGGCTCCCTGG - Intergenic
1124954007 15:34348077-34348099 GGGCTGTGGAGGTGGCTCCCTGG - Exonic
1124964628 15:34423882-34423904 AGGCAGTGGTGGTGGCCCCCTGG - Intronic
1124975305 15:34524378-34524400 GGGATGGGGTTGTGGCTCCCTGG - Intergenic
1124981245 15:34570108-34570130 AGGCAGTGGTGGTGGCCCCCTGG - Intronic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1127772286 15:62241785-62241807 GGGATGGGGTTGTGGCTCCCTGG - Intergenic
1128028661 15:64460804-64460826 GGGCGGAGGTGGCGGCTCCCGGG + Intronic
1128243641 15:66118356-66118378 GTGGTGCAGTGGAGGCACCCCGG - Intronic
1128454013 15:67822852-67822874 GGGCAGCGAGGATGGCACCCGGG - Intronic
1129039104 15:72670497-72670519 GGGATGGGGTTGTGGCTCCCTGG + Intergenic
1129079723 15:73028255-73028277 GAGCAGCTGTGGTGGCATCCAGG - Intergenic
1129210726 15:74066412-74066434 GGGATGGGGTTGTGGCTCCCTGG - Intergenic
1129399616 15:75274347-75274369 GGGATGGGGTTGTGGCTCCCTGG + Intronic
1129403285 15:75298917-75298939 GGGATGGGGTTGTGGCTCCCTGG + Intergenic
1130115597 15:81002090-81002112 GGGCTGCGGCGGCGGGAGCCCGG - Exonic
1130146433 15:81277651-81277673 AGGCTGAGATGGGGGCACCCTGG - Intronic
1130227864 15:82073398-82073420 GGGCAGCTGAAGTGGCACCCAGG + Intergenic
1130853710 15:87822316-87822338 GGGTAGCCCTGGTGGCACCCAGG + Intergenic
1131264055 15:90905408-90905430 GGGCTCCGGTGGCACCACCCAGG - Exonic
1132142911 15:99409686-99409708 TGGCTGCTGGGGTGGCATCCAGG - Intergenic
1132147205 15:99436121-99436143 GGGGTGGGGTGATGTCACCCTGG - Intergenic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132880560 16:2160066-2160088 GGGCTGGGGTGGAGGCAGCGAGG + Intronic
1132905177 16:2278795-2278817 GGGATGTGGTGGTGTGACCCAGG - Intronic
1132982058 16:2743287-2743309 GGGCTGGGGTGGGGGTATCCTGG - Intergenic
1134538612 16:15046532-15046554 GAGGTGCTGTGGGGGCACCCAGG + Intronic
1134669906 16:16047250-16047272 CGATTGCTGTGGTGGCACCCAGG + Intronic
1136364874 16:29805403-29805425 GGGCTGCGGGGGCGGGACCGGGG + Intergenic
1137477123 16:48818507-48818529 TGGCTGCGGTCCTGCCACCCAGG + Intergenic
1137769945 16:51008174-51008196 GGGCACTGGTGGTGGGACCCTGG - Intergenic
1139580964 16:67873352-67873374 GGGTTGCGGGGGTGGGCCCCAGG + Intronic
1141700432 16:85639734-85639756 GGGCGGCGGTGGAGGCTCCACGG - Intronic
1141752472 16:85968053-85968075 GGGCTCTGGTGGAGGCAACCTGG + Intergenic
1141805370 16:86338120-86338142 GGGTCCAGGTGGTGGCACCCAGG - Intergenic
1142118926 16:88376483-88376505 GGGCCCCGGAGGAGGCACCCGGG - Intergenic
1142120519 16:88384352-88384374 GGGCTGTGCTGGGGGCACCTAGG - Intergenic
1142123964 16:88401031-88401053 GGGCTGGGGTGGAGGGAGCCAGG - Intergenic
1142352186 16:89585603-89585625 GGGCTGCGATGGAGACACCTGGG + Intronic
1142684657 17:1570966-1570988 GGCCTGGGGTGGTGGCGCCTCGG + Intronic
1143130269 17:4673071-4673093 GGGCTGCAGGGGAGGAACCCGGG + Exonic
1144248927 17:13396227-13396249 GGCCTGCAATGGTGGCACTCTGG + Intergenic
1144626353 17:16846201-16846223 GGGCTGGGGTGGTGGCTGCCTGG - Intergenic
1144703540 17:17353344-17353366 GGGCTGCGCTTGTGGCCTCCTGG + Intergenic
1144880079 17:18426518-18426540 GGGCTGGGGTGGTGGCTGCCTGG + Intergenic
1144933467 17:18878918-18878940 GGAGTGCAGTGGTGGCACCTCGG + Intronic
1145152154 17:20517866-20517888 GGGCTGGGGTGGTGGCTGCCTGG - Intergenic
1146163512 17:30572084-30572106 GGGCTGGGGTGGTGGCTGCCTGG - Intergenic
1147360259 17:39925805-39925827 GGGCTGCGCTGATGGGTCCCAGG - Exonic
1147360601 17:39927402-39927424 GGGCTGCTGGGGAGGCGCCCCGG - Intronic
1147580499 17:41624899-41624921 AGGCTGGGGTGGTGGCTGCCTGG - Intergenic
1147683942 17:42276100-42276122 GGGCCGCGGTGGTTGCGCGCTGG - Intronic
1148623261 17:49050451-49050473 GGGCTGGGGTGAGGGCACCGTGG - Exonic
1148744399 17:49910349-49910371 GGCCTGCGGTCGGGGCACCGCGG + Intergenic
1149354088 17:55821912-55821934 GGGGTGAGGTGTTGGCTCCCAGG + Intronic
1149525838 17:57355119-57355141 GGGCTCCGGTGATGTCACCATGG + Intronic
1149545637 17:57501519-57501541 GGGATGGGGTGGGGGCAGCCTGG - Intronic
1149605836 17:57924622-57924644 GGGGTGGGGTGATGGGACCCAGG - Intronic
1150294130 17:63998791-63998813 GGGGTGGGGTGGGGGGACCCGGG - Intronic
1150314750 17:64159168-64159190 GGGCACCGGGGGTGGCAACCAGG - Intronic
1150695424 17:67400975-67400997 GGGGTGCGGTGGTGCCAACTCGG + Intronic
1150904848 17:69326801-69326823 GGGATGCGGTGGGAGCGCCCAGG - Intronic
1151601973 17:75111393-75111415 GGGGTGCGGTGGTGCCATCTTGG - Intronic
1152069235 17:78126880-78126902 GGGCTCCGGAGGTGGCGCCCAGG - Exonic
1152133809 17:78492486-78492508 GGCCTGCAATGGTGGCACCATGG - Intronic
1152140688 17:78534704-78534726 GGGCTGGGCTGGTGGCAGCCTGG + Intronic
1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG + Intergenic
1152366583 17:79860055-79860077 GGGCTGTGGTGTTGGGTCCCTGG + Intergenic
1152633577 17:81421344-81421366 GGGCTGGGGAGGTGGCAGCCTGG + Intronic
1152743815 17:82030246-82030268 GGGCTCCGGTGGGGGGCCCCGGG + Intronic
1152839886 17:82560489-82560511 GGGCTCCGGCGGTTCCACCCTGG + Intronic
1155182499 18:23359988-23360010 TGGCAGCGGTGGTGGGACTCAGG - Intronic
1155408810 18:25519491-25519513 GGGGTGCAGTGGTGGGACCTTGG + Intergenic
1157595772 18:48862766-48862788 GGGCTGCTCTGGTGGCGGCCTGG - Intronic
1158870006 18:61676993-61677015 TGGATTAGGTGGTGGCACCCAGG - Intergenic
1160753466 19:746423-746445 GGGCTGTGGAGGGGGCAGCCCGG + Exonic
1160991838 19:1863312-1863334 GGGCGGCGGGGGTGGCCCCGGGG + Exonic
1161111949 19:2475629-2475651 GGGCTGGGGTCGTCGCAGCCAGG + Intergenic
1161607374 19:5222496-5222518 GGGGGGCGGTGGTGCCACCGAGG + Intronic
1162668743 19:12237390-12237412 GACCTGCTGTGGTGGGACCCGGG - Intronic
1163696843 19:18768552-18768574 GGGCTGCGGCGGTGGCTGCTGGG - Exonic
1163845672 19:19637071-19637093 GGCCTGGGGTGATGGCACCCAGG + Intronic
1165144846 19:33724469-33724491 TGGCTGCGGGGCTGGCAGCCGGG + Intronic
1165893861 19:39130152-39130174 AGGGTGGGGTGGTGGGACCCAGG + Intronic
1167048741 19:47066562-47066584 GGGTGGCGGTGGTGGCAGCGGGG + Exonic
1167072353 19:47228281-47228303 GGGCGGCGGGGGCGGCAGCCAGG + Exonic
1168249588 19:55134171-55134193 GGGCTGTGATGGAGGCAGCCAGG + Exonic
1168315161 19:55481886-55481908 GGGCCGCGGAGGCGGTACCCGGG - Exonic
925696953 2:6590572-6590594 GGGGTGGGGTGGGAGCACCCTGG + Intergenic
926083916 2:10009521-10009543 GGGATGCGGTGGCAGCAGCCGGG + Intergenic
926667021 2:15536754-15536776 GGGCTGCTGTGGTTTCAGCCTGG - Intronic
927167859 2:20343366-20343388 GGAGTGCAGTGGTGTCACCCAGG - Intronic
930182881 2:48382534-48382556 GGGCTGTGGTGGGGGCACAAAGG + Intergenic
930800394 2:55437813-55437835 GAGTAGCTGTGGTGGCACCCAGG - Intergenic
933056735 2:77679835-77679857 GGAGTGCGGTGGTGGGACCTCGG - Intergenic
933926868 2:87100977-87100999 GGAGTGCGGTGGTGGGACCTCGG - Intergenic
935186249 2:100735864-100735886 TGGGTGCGATGGTGGAACCCAGG + Intergenic
935832019 2:107010424-107010446 GGGGTGGGGTTGAGGCACCCAGG + Intergenic
937345928 2:121125245-121125267 TGGCTGCCGTGGGAGCACCCAGG - Intergenic
937381695 2:121383207-121383229 GGGCTGCTGTGTAGGCACCCTGG - Intronic
937445586 2:121955301-121955323 GGGCTGGGCTGGTGGCCCCTTGG - Intergenic
938344328 2:130556618-130556640 GGGGTGCGGAGGTGTCACACAGG + Intergenic
938345505 2:130564104-130564126 GGGGTGCGGAGGTGTCACACAGG - Intergenic
938451398 2:131424872-131424894 GGGCTGCAGCGGAGGCACTCTGG - Intergenic
939153888 2:138502013-138502035 AGGCTGCGGTGGTGGCAGCAGGG - Exonic
940867978 2:158836128-158836150 GGGCTGTGGTGGAGGCACTAGGG - Intronic
941666268 2:168246876-168246898 GGGCTGCGGTCCCGGCACGCGGG + Intronic
942086172 2:172445751-172445773 GGTCTGAGGTGTTGGGACCCAGG + Intronic
944313297 2:198259002-198259024 GGGCAGCGGTCTTGGCACCAGGG + Intronic
944485377 2:200199866-200199888 GGGCTGGGGGCGTGGCTCCCAGG - Intergenic
945005352 2:205399403-205399425 GGGCTGCAGTGGTGCCATCTCGG + Intronic
945241550 2:207681450-207681472 GGGCGGCGGCGGGGGCACCCGGG - Intergenic
946197562 2:218044160-218044182 GGGCAGCTGCTGTGGCACCCAGG + Intronic
946231864 2:218296417-218296439 GGGAGGGGGTGGTGGCAGCCTGG + Intronic
946692462 2:222319680-222319702 GGCGTGCGGTGGCGGCACACCGG + Intergenic
947566682 2:231198641-231198663 CGGCTGCGGAGGTGGCGGCCGGG + Exonic
947713012 2:232326455-232326477 TGGCTCTGGCGGTGGCACCCTGG - Intronic
947720075 2:232364925-232364947 TGGCTCTGGTGATGGCACCCTGG - Intergenic
947732695 2:232439911-232439933 TGGCTGTGGTGGTGACGCCCTGG - Intergenic
948699657 2:239751758-239751780 GGCCTGGGGTGCTGGCAGCCAGG - Intergenic
948887289 2:240890631-240890653 GGGCTGAGGTGGTGGAGCCTTGG + Intronic
948973274 2:241445856-241445878 GGGCTGCACTGGTAGCTCCCAGG + Intronic
1169082328 20:2805110-2805132 GGGCTGCGGTGGAGGAGCCAAGG + Intergenic
1169863051 20:10172240-10172262 GGGGGGCGGGGGGGGCACCCAGG + Intergenic
1173251369 20:41365876-41365898 GGGCTGAGGAGGTGGCTGCCTGG + Intronic
1174581133 20:51572629-51572651 GGGTTGCTGTGGAGGCTCCCTGG - Intergenic
1175001476 20:55633924-55633946 GGGCTGCTGTGGCTGCACCTGGG + Intergenic
1175164158 20:57031313-57031335 GGGATGCGGGGCTGCCACCCTGG - Intergenic
1175216176 20:57392608-57392630 GGGCTGCCGTGGGGGGAACCAGG - Intronic
1176235711 20:64052571-64052593 GGGCTGGGCTGGTGGGATCCTGG - Intronic
1178367411 21:31999105-31999127 GGGCTGCAGTGGGGGCAGGCTGG - Exonic
1179272524 21:39862399-39862421 GGGCTGCAGAGGTGACACGCAGG + Intergenic
1179573996 21:42295496-42295518 GGAGTGCGGTGTTGGCACGCTGG + Intronic
1179982286 21:44901751-44901773 GGGCTGGGGAGGTGGCAGGCTGG + Intronic
1181438130 22:22922122-22922144 GGGCTGCAATGATGGCACCAGGG + Intergenic
1181588374 22:23867065-23867087 GGGCTGCACAGGTGGCTCCCTGG + Intronic
1182442857 22:30374209-30374231 GGGCTGCGCTGCTGGCCGCCTGG - Intronic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1183301459 22:37061015-37061037 GGGCTGCTGGGGGGGCACCAGGG + Intronic
1183321416 22:37167240-37167262 GGGCAGGGGTGCTGTCACCCAGG - Intronic
1183426294 22:37741127-37741149 GGGCTGAGGAGGAGGCACCTAGG + Intronic
953117366 3:40006400-40006422 AGGCTGCTGTGGTGGTCCCCAGG + Intronic
954105983 3:48410109-48410131 GGCCTGGGGAGGTGGCACCTGGG - Intronic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
955266943 3:57453622-57453644 AGGCTGCGGTGGTGGGATCTCGG + Intronic
960051969 3:113247748-113247770 GGGCTGTGGTGGTGGAAAGCTGG - Intronic
960965416 3:123101011-123101033 GGGCTGGGGAGATGGCCCCCAGG + Intronic
961741242 3:129034290-129034312 GGGCTGCGGTGGGAGGACCCTGG + Exonic
963250816 3:143101778-143101800 GGACTGCAGTGGTGGGATCCTGG - Intergenic
966908366 3:184543948-184543970 GGGGTGAGAAGGTGGCACCCAGG - Intronic
967829917 3:193909899-193909921 GGGGTGCCCTGGTGGCCCCCAGG + Intergenic
968084372 3:195867904-195867926 GGGCTCCCGCGGAGGCACCCGGG + Exonic
968211234 3:196850521-196850543 GGCCAGGGGTGGGGGCACCCGGG + Intergenic
968451608 4:678638-678660 GGCCTGCGGTGGGAGCACCATGG - Exonic
968451682 4:678919-678941 GGGCTGCTGTGCTGCCAACCCGG - Intronic
968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG + Intergenic
968909603 4:3470939-3470961 GCTCTGTGGTGGTGGCACCTTGG - Intronic
968915131 4:3493973-3493995 GGGCTGGGCTGGTGGAGCCCAGG - Exonic
969053049 4:4386399-4386421 GGGCTGGGGTGTGGGCGCCCAGG - Exonic
969543913 4:7811518-7811540 TGGCTGTGGTGGGGGCACCAGGG - Intronic
969621467 4:8280945-8280967 GGGCAGAGGTGGGGGCACCCAGG + Intronic
971019255 4:22517131-22517153 GGGCTGCGGTGTTCACACACAGG - Intergenic
975670055 4:76771599-76771621 GGGGTGCAGTGGAGACACCCTGG - Intronic
982020313 4:151196376-151196398 GGGCTGTGGTGGTGCCATCCTGG - Intronic
984023998 4:174521842-174521864 AGGCAGCGGAGGCGGCACCCAGG + Intronic
985714282 5:1446611-1446633 CGGCTCCGGGGCTGGCACCCAGG + Intergenic
986317004 5:6596122-6596144 GGGCTGTTGTGGAGGCACACAGG + Intergenic
988935483 5:36078517-36078539 GGGCAGCTGCAGTGGCACCCAGG + Intergenic
992940039 5:81751838-81751860 CCGCTGCGGTGGCGGCGCCCGGG + Intergenic
994107322 5:95961732-95961754 CGGCGGCGGCGGCGGCACCCCGG - Exonic
997627375 5:135340088-135340110 GGGATGAGGTGGTGGGACCTGGG + Intronic
998562073 5:143181077-143181099 GGGCTGAGGTGGTGGCAGTGGGG - Intronic
1001548663 5:172586663-172586685 GGGCTGAAGTGGAGCCACCCAGG - Intergenic
1002330140 5:178435344-178435366 GGGCTCCAGTGGTGACACCGTGG - Intronic
1003146539 6:3514823-3514845 AGGCTGGGGTGGAGGCACCAGGG + Intergenic
1006175811 6:32120865-32120887 GGGCTGCAGTGGCGGCTTCCGGG + Exonic
1006299362 6:33185510-33185532 GGCCTGTGGTGGGGGCTCCCAGG + Intronic
1007406069 6:41637154-41637176 GGGCTGGGGTGGTTGCGGCCCGG - Intronic
1007649837 6:43412629-43412651 GGGCTGCTGCATTGGCACCCTGG - Intergenic
1008446532 6:51598387-51598409 GGGCGGCGCTGGTGGGAACCGGG + Intergenic
1012511614 6:100009148-100009170 GTGCTGGGGTGGTGGGTCCCAGG + Intergenic
1013709522 6:112880361-112880383 GGGCGGCTGCAGTGGCACCCGGG + Intergenic
1013911122 6:115277832-115277854 GGGCTCCAGTGGGTGCACCCTGG + Intergenic
1014768510 6:125434673-125434695 GGGATGTGGTGGTGGCAGCAGGG + Intergenic
1014932958 6:127355667-127355689 CGGCAGCGGTGGTGGCAGTCAGG - Intergenic
1017339904 6:153309021-153309043 GGCATGTGGTGGTGGCAGCCAGG - Intergenic
1019337901 7:493955-493977 GGGCGGCGGCTGTGGCAGCCCGG - Intergenic
1019365137 7:629282-629304 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365221 7:629562-629584 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365308 7:629842-629864 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365326 7:629898-629920 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365345 7:629954-629976 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365364 7:630010-630032 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019462560 7:1168600-1168622 GGGATGGGGTGGGGACACCCAGG - Intergenic
1019512470 7:1424630-1424652 GGGGTGCTGTGGTGGTACACAGG - Intergenic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019979265 7:4609125-4609147 GGAGTGCGGTGGTGCCACCATGG - Intergenic
1020086315 7:5312692-5312714 GGGCTGCGGAGGAGGCGCCTGGG + Exonic
1021668645 7:23013558-23013580 GGGCCGAGGCGGCGGCACCCGGG + Intronic
1023016372 7:35971685-35971707 GGGCAGCGGCGGGGGCACCCGGG + Intergenic
1023663359 7:42493671-42493693 GGGCTGCGGGGGCGGTGCCCTGG + Intergenic
1024254659 7:47531799-47531821 GGGCAGCTGCAGTGGCACCCAGG - Intronic
1024736201 7:52307648-52307670 GGGCTCCAGTGATGCCACCCAGG + Intergenic
1025142584 7:56478480-56478502 GGGATGCGGTGATGGCAGCTGGG + Intergenic
1025205981 7:56993667-56993689 GGGCTGCCGTGGGGGCAGCAGGG + Intergenic
1025207992 7:57004380-57004402 GGGCTGCGGAGGAGGCGCCTGGG - Intergenic
1025663959 7:63572495-63572517 GGGCTGCGGAGGAGGCGCCTGGG + Intergenic
1025665959 7:63583272-63583294 GGGCTGCCGTGGGGGCAGCAGGG - Intergenic
1026525048 7:71146221-71146243 GGGCTGCGGTGGTGGCACCCGGG - Intronic
1028677386 7:93481326-93481348 GGGGTGGGGTGGGGGCAGCCAGG + Intronic
1029657599 7:101937203-101937225 GGGCTGGGGTGCTGACATCCCGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1029899159 7:104021850-104021872 GGGCAGCTGCAGTGGCACCCAGG - Intergenic
1029972799 7:104805577-104805599 GGGCTGCAGCTGTGCCACCCTGG - Intronic
1031899335 7:127392463-127392485 GAGCGGCGCTGGTGGGACCCGGG - Exonic
1034548641 7:151806136-151806158 GGGGTGCAGTGGTGGGATCCTGG - Intronic
1034970041 7:155413143-155413165 GGGCTGCTGTGGTGACAACAGGG + Intergenic
1035453774 7:158996367-158996389 GGGCTGCGGGGGTGGCTCTGGGG + Intergenic
1035589558 8:802339-802361 GGCCTGAGGTGGGGGGACCCAGG - Intergenic
1035628676 8:1092288-1092310 GGGCTGTGGAGGTGCCAGCCCGG - Intergenic
1035724015 8:1813701-1813723 GGGCTCTGGTGGTGACATCCAGG - Intergenic
1036664764 8:10731015-10731037 GGGCTGCGGTGGCCGAAGCCCGG - Intronic
1036793898 8:11741928-11741950 GGGCAGCGCTGGTGGGACGCTGG + Intronic
1039454294 8:37697291-37697313 CGGCTGCGGAGGCGGCGCCCGGG - Exonic
1039612793 8:38932637-38932659 GGGCTGCCGATGTGTCACCCTGG + Intronic
1040033988 8:42851123-42851145 GGGCTGTGGTGGTAGAGCCCAGG - Intronic
1040439280 8:47424191-47424213 GTGCAGCAGTGGTTGCACCCTGG + Intronic
1041318318 8:56587414-56587436 GTGCTTCTGTGGAGGCACCCGGG + Intergenic
1043652164 8:82609992-82610014 GGAGTGCAGTGGTGCCACCCCGG - Intergenic
1048214269 8:132480880-132480902 CGGCGGCGGCGGCGGCACCCAGG + Exonic
1048581314 8:135731755-135731777 GGGCTGCAGGGGTGCCACCTGGG - Intergenic
1048744523 8:137599239-137599261 GGGGTGGGGTGGTATCACCCAGG + Intergenic
1049013053 8:139900379-139900401 AGGGTGCAGTGGTGGCAGCCAGG - Intronic
1049266611 8:141671060-141671082 AGGCAGAGGAGGTGGCACCCAGG - Intergenic
1049412040 8:142477822-142477844 GGTGTGGGGTGGTGGCCCCCAGG + Intronic
1049412073 8:142477917-142477939 GGTGTGGGGTGGTGGCCCCCAGG + Intronic
1049412125 8:142478086-142478108 GGTGTGGGGTGGTAGCACCCAGG + Intronic
1049616356 8:143577377-143577399 GCGCTGCGTTGGTGGCCACCAGG + Exonic
1049625630 8:143618556-143618578 GGGGTGCGGTGGCGCCACCTGGG - Intergenic
1049643470 8:143725875-143725897 GGGCAGCGATGCGGGCACCCTGG + Exonic
1049693406 8:143972598-143972620 GGGTCGCGGTGGGGGCCCCCAGG - Intronic
1049821552 8:144636728-144636750 GGGGTGCGGGAGTGTCACCCCGG - Intergenic
1050483855 9:6114113-6114135 GGGCAGCTGCAGTGGCACCCAGG - Intergenic
1051338021 9:16084669-16084691 GGGCTGCCATGGGGGCCCCCAGG + Intergenic
1051665645 9:19464977-19464999 GGGCTGCGGCGGGGGCGGCCAGG + Intergenic
1053011688 9:34637360-34637382 GAGCTGCGGCGGCTGCACCCAGG - Exonic
1057024310 9:91724043-91724065 GAGCTGCGGCGGGGGCACCATGG + Exonic
1057814398 9:98284011-98284033 GGGCTGCTGTGGCTGCACCAAGG - Intergenic
1058871713 9:109207519-109207541 GGGCTGCAGTGGTGGGATCATGG - Intronic
1060106477 9:120876440-120876462 GGGCTGGGGGGGCGCCACCCGGG - Intronic
1061062154 9:128255885-128255907 GGGATGGGGTCGTGGCGCCCTGG - Exonic
1061090225 9:128421813-128421835 GGGCTGGGGGGGTGGAGCCCTGG + Intronic
1061133014 9:128718733-128718755 GGTCTGGGGTGGTGGAACCAGGG - Intronic
1061899620 9:133666247-133666269 GGGGTGCAGGGGTGGCCCCCAGG - Intronic
1062302489 9:135882787-135882809 GGTCTGCGGTGGCCGCCCCCAGG - Intronic
1062382411 9:136292830-136292852 GGGCAGCGGTGAAGGCTCCCCGG + Intronic
1062436708 9:136549579-136549601 AGGCTGCGTAGGAGGCACCCTGG - Intergenic
1062503030 9:136859327-136859349 GGGCTGCAGTGGAGGCACGGAGG + Intronic
1062535247 9:137018484-137018506 GGGCTGGGGTGGGGGCCCCAGGG + Intronic
1188530249 X:31132509-31132531 TGGCTGCCCTGTTGGCACCCTGG - Intronic
1190640106 X:52475976-52475998 GGGCTGCAGCAGTGGCAACCCGG - Intergenic
1190647566 X:52536889-52536911 GGGCTGCAGCAGTGGCAACCCGG + Intergenic
1192153176 X:68724437-68724459 GGGCCTGGGTGGTGCCACCCTGG - Exonic
1192363096 X:70451688-70451710 GGACTGCGGAGGAGGAACCCTGG + Intronic
1193775924 X:85641797-85641819 GGGATGGGGTCGTGGCTCCCAGG + Intergenic
1196840220 X:119852838-119852860 AGGCAGCGGTGGTGGGACCTCGG - Exonic
1197635347 X:128908622-128908644 GGGCAGCAGTGGTGGCACAGAGG - Intergenic
1198469309 X:136931178-136931200 GGGCCGCGGTGGTGGTGCCAAGG + Intergenic
1198792903 X:140364938-140364960 GAGCTGCTGTTGTGCCACCCAGG + Intergenic
1198795074 X:140385790-140385812 TGGCAGTGGTGGTGGCCCCCAGG - Intergenic